LOCUS CP019935 1839134 bp DNA circular BCT 03-MAR-2017
DEFINITION Streptococcus thermophilus strain APC151, complete genome.
ACCESSION CP019935
VERSION CP019935.1
DBLINK BioProject: PRJNA376088
BioSample: SAMN06349996
KEYWORDS .
SOURCE Streptococcus thermophilus
ORGANISM Streptococcus thermophilus
Bacteria; Firmicutes; Bacilli; Lactobacillales; Streptococcaceae;
Streptococcus.
REFERENCE 1 (bases 1 to 1839134)
AUTHORS Linares,D.M., Arboleya,S., Ross,P. and Stanton,C.
TITLE Complete genome sequence of the gamma-aminobutyric acid-producing
strain Streptococcus thermophilus APC151
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 1839134)
AUTHORS Linares,D.M., Arboleya,S., Ross,P. and Stanton,C.
TITLE Direct Submission
JOURNAL Submitted (23-FEB-2017) Food Biosciences, Teagasc Food Research,
Moorepark, Fermoy 000000, Ireland
COMMENT Bacteria and source DNA available from Teagasc Food Research.
Annotation was added by the NCBI Prokaryotic Genome Annotation
Pipeline (released 2013). Information about the Pipeline can be
found here: https://www.ncbi.nlm.nih.gov/genome/annotation_prok/
##Genome-Assembly-Data-START##
Assembly Method :: other v. HGAP3
Genome Representation :: Full
Expected Final Version :: Yes
Genome Coverage :: 423.0x
Sequencing Technology :: PacBio
##Genome-Assembly-Data-END##
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Date :: 02/23/2017 16:25:06
Annotation Pipeline :: NCBI Prokaryotic Genome
Annotation Pipeline
Annotation Method :: Best-placed reference protein
set; GeneMarkS+
Annotation Software revision :: 4.0
Features Annotated :: Gene; CDS; rRNA; tRNA; ncRNA;
repeat_region
Genes (total) :: 1,997
CDS (total) :: 1,908
Genes (coding) :: 1,700
CDS (coding) :: 1,700
Genes (RNA) :: 89
rRNAs :: 6, 6, 6 (5S, 16S, 23S)
complete rRNAs :: 6, 6, 6 (5S, 16S, 23S)
tRNAs :: 67
ncRNAs :: 4
Pseudo Genes (total) :: 208
Pseudo Genes (ambiguous residues) :: 0 of 208
Pseudo Genes (frameshifted) :: 129 of 208
Pseudo Genes (incomplete) :: 46 of 208
Pseudo Genes (internal stop) :: 97 of 208
Pseudo Genes (multiple problems) :: 59 of 208
CRISPR Arrays :: 2
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..1839134
/organism="Streptococcus thermophilus"
/mol_type="genomic DNA"
/strain="APC151"
/isolation_source="intestine"
/host="fish"
/db_xref="taxon:1308"
/country="Ireland"
/collection_date="13-Feb-2015"
gene complement(135..2297)
/locus_tag="B1761_00005"
CDS complement(135..2297)
/locus_tag="B1761_00005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621472.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="copper-translocating P-type ATPase"
/protein_id="AQW32865.1"
gene complement(2488..3664)
/locus_tag="B1761_00010"
/pseudo
CDS complement(2488..3664)
/locus_tag="B1761_00010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011675534.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS256 family transposase"
gene complement(3759..4769)
/locus_tag="B1761_00015"
/pseudo
CDS complement(3759..4769)
/locus_tag="B1761_00015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015639662.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="restriction endonuclease subunit R"
gene complement(4834..5043)
/locus_tag="B1761_00020"
CDS complement(4834..5043)
/locus_tag="B1761_00020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227127.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32866.1"
gene 5515..6426
/locus_tag="B1761_00025"
CDS 5515..6426
/locus_tag="B1761_00025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012212307.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cysteine synthase"
/protein_id="AQW32867.1"
gene 6448..7632
/locus_tag="B1761_00030"
CDS 6448..7632
/locus_tag="B1761_00030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225851.1"
/note="catalyzes the formation of cystathionine from
L-cysteine and O-succinyl-L-homoserine; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cystathionine gamma-synthase"
/protein_id="AQW32868.1"
gene 7598..8155
/locus_tag="B1761_00035"
CDS 7598..8155
/locus_tag="B1761_00035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003551679.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine acetyltransferase"
/protein_id="AQW34497.1"
gene 8430..8600
/locus_tag="B1761_00040"
CDS 8430..8600
/locus_tag="B1761_00040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621479.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW32869.1"
gene 8685..9861
/locus_tag="B1761_00045"
/pseudo
CDS 8685..9861
/locus_tag="B1761_00045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011675534.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS256 family transposase"
gene complement(9914..10006)
/locus_tag="B1761_00050"
/pseudo
CDS complement(9914..10006)
/locus_tag="B1761_00050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000512454.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="NUDIX hydrolase"
gene 10005..11180
/locus_tag="B1761_00055"
CDS 10005..11180
/locus_tag="B1761_00055"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011675534.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS256 family transposase"
/protein_id="AQW32870.1"
gene 11293..12180
/locus_tag="B1761_00060"
CDS 11293..12180
/locus_tag="B1761_00060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003132622.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sugar transporter"
/protein_id="AQW32871.1"
gene complement(12254..12456)
/locus_tag="B1761_00065"
/pseudo
CDS complement(12254..12456)
/locus_tag="B1761_00065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015427246.1"
/note="frameshifted; internal stop; incomplete; partial on
complete genome; missing start; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 12796..12990
/locus_tag="B1761_00070"
CDS 12796..12990
/locus_tag="B1761_00070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197923.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type I restriction endonuclease subunit R"
/protein_id="AQW32872.1"
gene 13030..13554
/locus_tag="B1761_00075"
/pseudo
CDS 13030..13554
/locus_tag="B1761_00075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015082072.1"
/note="frameshifted; incomplete; partial on complete
genome; missing stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="type I restriction endonuclease subunit M"
gene complement(13812..14504)
/locus_tag="B1761_00080"
CDS complement(13812..14504)
/locus_tag="B1761_00080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621488.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PrsW family intramembrane metalloprotease"
/protein_id="AQW32873.1"
gene 14661..16205
/locus_tag="B1761_00085"
CDS 14661..16205
/locus_tag="B1761_00085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097361.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="zinc ABC transporter substrate-binding protein
AdcA"
/protein_id="AQW32874.1"
gene 16420..16818
/locus_tag="B1761_00090"
CDS 16420..16818
/locus_tag="B1761_00090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182418.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32875.1"
gene 16979..17278
/locus_tag="B1761_00095"
CDS 16979..17278
/locus_tag="B1761_00095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681071.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32876.1"
gene complement(17333..18340)
/locus_tag="B1761_00100" CDS complement(17333..18340)
/locus_tag="B1761_00100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227143.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32877.1"
gene 18513..19226
/locus_tag="B1761_00105"
CDS 18513..19226
/locus_tag="B1761_00105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097360.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetylmuramidase"
/protein_id="AQW32878.1"
gene 19628..20108
/locus_tag="B1761_00110"
/pseudo
CDS 19628..20108
/locus_tag="B1761_00110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680582.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(20205..21113)
/locus_tag="B1761_00115"
CDS complement(20205..21113)
/locus_tag="B1761_00115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634578.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LysR family transcriptional regulator"
/protein_id="AQW32879.1"
gene 21321..23129
/locus_tag="B1761_00120"
CDS 21321..23129
/locus_tag="B1761_00120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621492.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine--fructose-6-phosphate
aminotransferase"
/protein_id="AQW32880.1"
gene 23246..23575
/locus_tag="B1761_00125"
CDS 23246..23575
/locus_tag="B1761_00125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004229989.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="protein PhnA"
/protein_id="AQW32881.1"
gene 23770..24411
/locus_tag="B1761_00130"
CDS 23770..24411
/locus_tag="B1761_00130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009854101.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter permease"
/protein_id="AQW32882.1"
gene 24420..25049
/locus_tag="B1761_00135"
CDS 24420..25049
/locus_tag="B1761_00135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009854102.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter ATP-binding protein"
/protein_id="AQW32883.1"
gene 25062..25913
/locus_tag="B1761_00140"
CDS 25062..25913
/locus_tag="B1761_00140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681077.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter substrate-binding
protein"
/protein_id="AQW32884.1"
gene 26149..26376
/locus_tag="B1761_00145"
CDS 26149..26376
/locus_tag="B1761_00145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608241.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34498.1"
gene 26376..27197
/locus_tag="B1761_00150"
CDS 26376..27197
/locus_tag="B1761_00150"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608242.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type VI secretion protein ImpB"
/protein_id="AQW32885.1"
gene 27275..27466
/locus_tag="B1761_00155"
CDS 27275..27466
/locus_tag="B1761_00155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950584.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32886.1"
gene 27645..27830
/locus_tag="B1761_00160"
CDS 27645..27830
/locus_tag="B1761_00160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608244.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32887.1"
gene 27968..28321
/locus_tag="B1761_00165"
CDS 27968..28321
/locus_tag="B1761_00165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225875.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alcohol dehydrogenase"
/protein_id="AQW34499.1"
gene 28335..28982
/locus_tag="B1761_00170"
CDS 28335..28982
/locus_tag="B1761_00170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727524.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alcohol dehydrogenase AdhP"
/protein_id="AQW32888.1"
gene complement(29407..29706)
/locus_tag="B1761_00175"
CDS complement(29407..29706)
/locus_tag="B1761_00175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727523.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32889.1"
gene complement(29929..31491)
/locus_tag="B1761_00180"
CDS complement(29929..31491)
/locus_tag="B1761_00180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009880616.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GMP synthetase"
/protein_id="AQW32890.1"
gene 31660..32358
/locus_tag="B1761_00185"
CDS 31660..32358
/locus_tag="B1761_00185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092716.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GntR family transcriptional regulator"
/protein_id="AQW32891.1"
gene 32425..32757
/locus_tag="B1761_00190"
CDS 32425..32757
/locus_tag="B1761_00190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017649495.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
/protein_id="AQW32892.1"
gene 32790..34352
/locus_tag="B1761_00195"
CDS 32790..34352
/locus_tag="B1761_00195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018378679.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="signal recognition particle protein"
/protein_id="AQW32893.1"
gene 34455..34982
/locus_tag="B1761_00200"
CDS 34455..34982
/locus_tag="B1761_00200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093073.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32894.1"
gene 35006..35521
/locus_tag="B1761_00205"
CDS 35006..35521
/locus_tag="B1761_00205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621521.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding transcriptional regulator"
/protein_id="AQW32895.1"
gene 35616..36305
/locus_tag="B1761_00210"
CDS 35616..36305
/locus_tag="B1761_00210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006739575.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
/protein_id="AQW32896.1"
gene 36433..37287
/locus_tag="B1761_00215"
CDS 36433..37287
/locus_tag="B1761_00215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990510.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosome biogenesis GTPase YlqF"
/protein_id="AQW32897.1"
gene 37274..38041
/locus_tag="B1761_00220"
CDS 37274..38041
/locus_tag="B1761_00220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608254.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease HII"
/protein_id="AQW32898.1"
gene 38052..38972
/locus_tag="B1761_00225"
CDS 38052..38972
/locus_tag="B1761_00225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950604.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW32899.1"
gene 39039..39878
/locus_tag="B1761_00230"
CDS 39039..39878
/locus_tag="B1761_00230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534747.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA processing protein DprA"
/protein_id="AQW32900.1"
gene 40046..42190
/locus_tag="B1761_00235"
CDS 40046..42190
/locus_tag="B1761_00235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227156.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA topoisomerase I"
/protein_id="AQW32901.1"
gene 42307..43131
/locus_tag="B1761_00240"
CDS 42307..43131
/locus_tag="B1761_00240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621524.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32902.1"
gene 43167..43826
/locus_tag="B1761_00245"
CDS 43167..43826
/locus_tag="B1761_00245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621525.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
/protein_id="AQW32903.1"
gene 43916..45211
/locus_tag="B1761_00250"
CDS 43916..45211
/locus_tag="B1761_00250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727520.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="two-component sensor histidine kinase"
/protein_id="AQW34500.1"
gene 45312..46655
/locus_tag="B1761_00255"
CDS 45312..46655
/locus_tag="B1761_00255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947913.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="FADH(2)-oxidizing
methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-
methyltransferase TrmFO"
/protein_id="AQW32904.1"
gene complement(46725..47651)
/locus_tag="B1761_00260"
/pseudo
CDS complement(46725..47651)
/locus_tag="B1761_00260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003070899.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="5-methyltetrahydropteroyltriglutamate--
homocysteine methyltransferase"
gene 48022..48450
/locus_tag="B1761_00265"
CDS 48022..48450
/locus_tag="B1761_00265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097258.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nucleoside-diphosphate kinase"
/protein_id="AQW32905.1"
gene 48452..48745
/locus_tag="B1761_00270"
CDS 48452..48745
/locus_tag="B1761_00270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681089.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sulfurtransferase"
/protein_id="AQW32906.1"
gene 48956..49297
/locus_tag="B1761_00275"
CDS 48956..49297
/locus_tag="B1761_00275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947907.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetoin dehydrogenase"
/protein_id="AQW32907.1"
gene 49514..49719
/locus_tag="B1761_00280"
/pseudo
CDS 49514..49719
/locus_tag="B1761_00280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947906.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="acetoin dehydrogenase"
gene 50107..51939
/locus_tag="B1761_00285"
CDS 50107..51939
/locus_tag="B1761_00285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608261.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="elongation factor 4"
/protein_id="AQW32908.1"
gene 51994..52128
/locus_tag="B1761_00290"
/pseudo
CDS 51994..52128
/locus_tag="B1761_00290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225900.1"
/note="internal stop; incomplete; partial on complete
genome; missing start; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="XRE family transcriptional regulator"
gene 52462..53319
/locus_tag="B1761_00295"
CDS 52462..53319
/locus_tag="B1761_00295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727518.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MutR family transcriptional regulator"
/protein_id="AQW32909.1"
gene 53379..54179
/locus_tag="B1761_00300"
CDS 53379..54179
/locus_tag="B1761_00300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225902.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Fe-S oxidoreductase"
/protein_id="AQW32910.1"
gene 54590..55687
/locus_tag="B1761_00305"
CDS 54590..55687
/locus_tag="B1761_00305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225904.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="radical SAM/SPASM domain-containing protein"
/protein_id="AQW32911.1"
gene 55684..56427
/locus_tag="B1761_00310"
CDS 55684..56427
/locus_tag="B1761_00310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225905.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="agmatinase"
/protein_id="AQW32912.1"
gene 56434..57606
/locus_tag="B1761_00315"
CDS 56434..57606
/locus_tag="B1761_00315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681092.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MFS transporter"
/protein_id="AQW32913.1"
gene 57860..59536
/locus_tag="B1761_00320"
CDS 57860..59536
/locus_tag="B1761_00320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019804322.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetolactate synthase"
/protein_id="AQW32914.1"
gene 59552..60271
/locus_tag="B1761_00325"
CDS 59552..60271
/locus_tag="B1761_00325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534730.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alpha-acetolactate decarboxylase"
/protein_id="AQW32915.1"
gene complement(60323..61580)
/locus_tag="B1761_00330"
/pseudo
CDS complement(60323..61580)
/locus_tag="B1761_00330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608187.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(61797..62541)
/locus_tag="B1761_00335"
/pseudo
CDS complement(61797..62541)
/locus_tag="B1761_00335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950652.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
gene 62682..63515
/locus_tag="B1761_00340"
CDS 62682..63515
/locus_tag="B1761_00340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225913.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dehydrogenase"
/protein_id="AQW32916.1"
gene complement(63571..63904)
/locus_tag="B1761_00345"
/pseudo
CDS complement(63571..63904)
/locus_tag="B1761_00345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885009.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="glucuronide permease"
gene complement(63943..64482)
/locus_tag="B1761_00350"
CDS complement(63943..64482)
/locus_tag="B1761_00350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097214.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="TetR family transcriptional regulator"
/protein_id="AQW32917.1"
gene 64616..65512
/locus_tag="B1761_00355"
CDS 64616..65512
/locus_tag="B1761_00355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950656.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cation transporter"
/protein_id="AQW32918.1"
gene 65624..66718
/locus_tag="B1761_00360"
CDS 65624..66718
/locus_tag="B1761_00360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003018779.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ferrochelatase"
/protein_id="AQW32919.1"
gene 66815..67852
/locus_tag="B1761_00365"
CDS 66815..67852
/locus_tag="B1761_00365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000833750.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Zn-dependent alcohol dehydrogenase"
/protein_id="AQW32920.1"
gene 68301..68444
/locus_tag="B1761_00370"
CDS 68301..68444
/locus_tag="B1761_00370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950659.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32921.1"
gene 68523..68972
/locus_tag="B1761_00375"
CDS 68523..68972
/locus_tag="B1761_00375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608270.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alpha/beta hydrolase"
/protein_id="AQW32922.1"
gene complement(69028..70356)
/locus_tag="B1761_00380"
CDS complement(69028..70356)
/locus_tag="B1761_00380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607930.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
/protein_id="AQW32923.1"
gene 70607..70861
/locus_tag="B1761_00385"
CDS 70607..70861
/locus_tag="B1761_00385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950660.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32924.1"
gene 70858..71310
/locus_tag="B1761_00390"
CDS 70858..71310
/locus_tag="B1761_00390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608271.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32925.1"
gene 71656..72420
/locus_tag="B1761_00395"
CDS 71656..72420
/locus_tag="B1761_00395"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948370.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphorylase"
/protein_id="AQW32926.1"
gene complement(72482..73117)
/locus_tag="B1761_00400"
CDS complement(72482..73117)
/locus_tag="B1761_00400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608272.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoglycolate phosphatase"
/protein_id="AQW32927.1"
gene 73318..73536
/locus_tag="B1761_00405"
CDS 73318..73536
/locus_tag="B1761_00405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727509.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32928.1"
gene 73579..73854
/locus_tag="B1761_00410"
CDS 73579..73854
/locus_tag="B1761_00410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681100.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32929.1"
gene complement(73851..74174)
/locus_tag="B1761_00415"
CDS complement(73851..74174)
/locus_tag="B1761_00415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950675.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug transporter"
/protein_id="AQW32930.1"
gene complement(74132..74398)
/locus_tag="B1761_00420"
CDS complement(74132..74398)
/locus_tag="B1761_00420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621542.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32931.1"
gene complement(74395..74862)
/locus_tag="B1761_00425"
CDS complement(74395..74862)
/locus_tag="B1761_00425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608273.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-damage-inducible protein"
/protein_id="AQW32932.1"
gene complement(74907..75242)
/locus_tag="B1761_00430"
CDS complement(74907..75242)
/locus_tag="B1761_00430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608274.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="damage-inducible protein"
/protein_id="AQW32933.1"
gene complement(75332..75505)
/locus_tag="B1761_00435"
/pseudo
CDS complement(75332..75505)
/locus_tag="B1761_00435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990575.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="tryptophan permease"
gene 75505..75714
/locus_tag="B1761_00440"
CDS 75505..75714
/locus_tag="B1761_00440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952951.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32934.1"
gene complement(76090..77748)
/locus_tag="B1761_00445"
CDS complement(76090..77748)
/locus_tag="B1761_00445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885107.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32935.1"
gene 78047..79027
/locus_tag="B1761_00450"
CDS 78047..79027
/locus_tag="B1761_00450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681102.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32936.1"
gene 79333..79818
/locus_tag="B1761_00455"
CDS 79333..79818
/locus_tag="B1761_00455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607832.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NUDIX hydrolase"
/protein_id="AQW32937.1"
gene 79822..80013
/locus_tag="B1761_00460"
CDS 79822..80013
/locus_tag="B1761_00460"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681104.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32938.1"
gene 80450..80668
/locus_tag="B1761_00465"
CDS 80450..80668
/locus_tag="B1761_00465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681105.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32939.1"
gene 80870..81538
/locus_tag="B1761_00470"
CDS 80870..81538
/locus_tag="B1761_00470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621543.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LaaN protein"
/protein_id="AQW32940.1"
gene 81539..81658
/locus_tag="B1761_00475"
/pseudo
CDS 81539..81658
/locus_tag="B1761_00475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003036145.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 81805..82353
/locus_tag="B1761_00480"
CDS 81805..82353
/locus_tag="B1761_00480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990578.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DJ-1 family protein"
/protein_id="AQW32941.1"
gene complement(82410..82625)
/locus_tag="B1761_00485"
CDS complement(82410..82625)
/locus_tag="B1761_00485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681107.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34501.1"
gene 82594..83397
/locus_tag="B1761_00490"
CDS 82594..83397
/locus_tag="B1761_00490"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225931.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydroorotate dehydrogenase electron transfer
subunit"
/protein_id="AQW32942.1"
gene 83416..84363
/locus_tag="B1761_00495"
CDS 83416..84363
/locus_tag="B1761_00495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952957.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydroorotate dehydrogenase B catalytic
subunit"
/protein_id="AQW32943.1"
gene 84502..85302
/locus_tag="B1761_00500"
CDS 84502..85302
/locus_tag="B1761_00500"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608280.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CRISPR-associated endonuclease Cas1"
/protein_id="AQW32944.1"
gene 85506..85835
/locus_tag="B1761_00505"
CDS 85506..85835
/locus_tag="B1761_00505"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608281.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CRISPR-associated endonuclease Cas2"
/protein_id="AQW32945.1"
gene 86174..86905
/locus_tag="B1761_00510"
CDS 86174..86905
/locus_tag="B1761_00510"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950679.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CRISPR-associated endoribonuclease Cas6"
/protein_id="AQW32946.1"
gene 86886..89162
/locus_tag="B1761_00515"
CDS 86886..89162
/locus_tag="B1761_00515"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608282.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type III-A CRISPR-associated protein Cas10/Csm1"
/protein_id="AQW32947.1"
gene 89166..89546
/locus_tag="B1761_00520"
CDS 89166..89546
/locus_tag="B1761_00520"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950682.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type III-A CRISPR-associated protein Csm2"
/protein_id="AQW32948.1"
gene 89546..90208
/locus_tag="B1761_00525"
CDS 89546..90208
/locus_tag="B1761_00525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950683.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type III-A CRISPR-associated RAMP protein Csm3"
/protein_id="AQW32949.1"
gene 90210..91109
/locus_tag="B1761_00530"
CDS 90210..91109
/locus_tag="B1761_00530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227185.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type III-A CRISPR-associated RAMP protein Csm4"
/protein_id="AQW32950.1"
gene 91112..92185
/locus_tag="B1761_00535"
CDS 91112..92185
/locus_tag="B1761_00535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621550.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type III-A CRISPR-associated RAMP protein Csm5"
/protein_id="AQW32951.1"
gene 92339..93514
/locus_tag="B1761_00540"
CDS 92339..93514
/locus_tag="B1761_00540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009013942.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type III-A CRISPR-associated protein Csm6"
/protein_id="AQW32952.1"
gene 93714..94409
/locus_tag="B1761_00545"
CDS 93714..94409
/locus_tag="B1761_00545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946679.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="orotidine 5'-phosphate decarboxylase"
/protein_id="AQW32953.1"
gene 94498..95127
/locus_tag="B1761_00550"
CDS 94498..95127
/locus_tag="B1761_00550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376227.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="orotate phosphoribosyltransferase"
/protein_id="AQW32954.1"
gene 95269..95773
/locus_tag="B1761_00555"
/pseudo
CDS 95269..95773
/locus_tag="B1761_00555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225942.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="amidase"
gene complement(95824..97275)
/locus_tag="B1761_00560"
CDS complement(95824..97275)
/locus_tag="B1761_00560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_010001162.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MFS transporter"
/protein_id="AQW32955.1"
gene 97696..98298
/locus_tag="B1761_00565"
CDS 97696..98298
/locus_tag="B1761_00565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727505.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amidase"
/protein_id="AQW34502.1"
gene 98402..99199
/locus_tag="B1761_00570"
CDS 98402..99199
/locus_tag="B1761_00570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608289.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter substrate-binding protein"
/protein_id="AQW34503.1"
gene 99338..99910
/locus_tag="B1761_00575"
CDS 99338..99910
/locus_tag="B1761_00575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608290.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter permease"
/protein_id="AQW32956.1"
gene 100044..100274
/locus_tag="B1761_00580"
CDS 100044..100274
/locus_tag="B1761_00580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947218.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32957.1"
gene 100776..101571
/locus_tag="B1761_00585"
/pseudo
CDS 100776..101571
/locus_tag="B1761_00585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092655.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(101781..102638)
/locus_tag="B1761_00590"
/pseudo
CDS complement(101781..102638)
/locus_tag="B1761_00590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003062117.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="AraC family transcriptional regulator"
gene complement(102619..102747)
/locus_tag="B1761_00595"
CDS complement(102619..102747)
/locus_tag="B1761_00595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608292.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="AraC family transcriptional regulator"
/protein_id="AQW32958.1"
gene 102963..104220
/locus_tag="B1761_00600"
/pseudo
CDS 102963..104220
/locus_tag="B1761_00600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621432.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(104283..105653)
/locus_tag="B1761_00605"
CDS complement(104283..105653)
/locus_tag="B1761_00605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003051082.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA uridine-5-carboxymethylaminomethyl(34)
synthesis GTPase MnmE"
/protein_id="AQW32959.1"
gene complement(105782..107125)
/locus_tag="B1761_00610"
CDS complement(105782..107125)
/locus_tag="B1761_00610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227196.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sodium:alanine symporter family protein"
/protein_id="AQW32960.1"
regulatory complement(107220..107326)
/regulatory_class="riboswitch"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00504"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="glycine riboswitch; Derived by automated
computational analysis using gene prediction method:
cmsearch."
/bound_moiety="glycine"
/db_xref="RFAM:RF00504"
gene 107641..109953
/locus_tag="B1761_00615"
CDS 107641..109953
/locus_tag="B1761_00615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621565.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA helicase PcrA"
/protein_id="AQW32961.1"
gene 110074..111354
/locus_tag="B1761_00620"
CDS 110074..111354
/locus_tag="B1761_00620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621566.1"
/note="catalyzes the formation of L-methionine and acetate
from O-acetyl-L-homoserine and methanethiol; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="O-acetylhomoserine
aminocarboxypropyltransferase"
/protein_id="AQW34504.1"
gene 111415..111756
/locus_tag="B1761_00625"
CDS 111415..111756
/locus_tag="B1761_00625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950714.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="haloacid dehalogenase"
/protein_id="AQW32962.1"
gene 111802..112170
/locus_tag="B1761_00630"
CDS 111802..112170
/locus_tag="B1761_00630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950716.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32963.1"
gene 112235..112729
/locus_tag="B1761_00635"
CDS 112235..112729
/locus_tag="B1761_00635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182514.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2-Cys peroxiredoxin"
/protein_id="AQW32964.1"
gene 112852..113472
/locus_tag="B1761_00640"
CDS 112852..113472
/locus_tag="B1761_00640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621568.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="restriction endonuclease subunit S"
/protein_id="AQW32965.1"
gene 113491..113698
/locus_tag="B1761_00645"
/pseudo
CDS 113491..113698
/locus_tag="B1761_00645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950722.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 113739..114985
/locus_tag="B1761_00650"
/pseudo
CDS 113739..114985
/locus_tag="B1761_00650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002312832.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hemerythrin HHE cation-binding protein"
gene 115152..116033
/locus_tag="B1761_00655"
CDS 115152..116033
/locus_tag="B1761_00655"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227200.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA pseudouridine(55) synthase TruB"
/protein_id="AQW32966.1"
gene 116030..116950
/locus_tag="B1761_00660"
CDS 116030..116950
/locus_tag="B1761_00660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950726.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional riboflavin kinase/FMN
adenylyltransferase"
/protein_id="AQW32967.1"
gene 117011..117424
/locus_tag="B1761_00665"
CDS 117011..117424
/locus_tag="B1761_00665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950728.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator Spx"
/protein_id="AQW32968.1"
gene 117417..117698
/locus_tag="B1761_00670"
CDS 117417..117698
/locus_tag="B1761_00670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002943735.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32969.1"
gene 117688..118455
/locus_tag="B1761_00675"
CDS 117688..118455
/locus_tag="B1761_00675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950732.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="inositol monophosphatase"
/protein_id="AQW32970.1"
gene 118538..119848
/locus_tag="B1761_00680"
CDS 118538..119848
/locus_tag="B1761_00680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681131.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA methyltransferase"
/protein_id="AQW32971.1"
gene 119973..120848
/locus_tag="B1761_00685"
CDS 119973..120848
/locus_tag="B1761_00685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950736.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphate-binding protein"
/protein_id="AQW32972.1"
gene 120851..121765
/locus_tag="B1761_00690"
CDS 120851..121765
/locus_tag="B1761_00690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012678021.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphate ABC transporter permease subunit PstC"
/protein_id="AQW32973.1"
gene 121755..122639
/locus_tag="B1761_00695"
CDS 121755..122639
/locus_tag="B1761_00695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009443446.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphate ABC transporter, permease protein
PstA"
/protein_id="AQW32974.1"
gene 122650..123453
/locus_tag="B1761_00700"
CDS 122650..123453
/locus_tag="B1761_00700"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002294803.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphate ABC transporter ATP-binding protein"
/protein_id="AQW32975.1"
gene 123466..124223
/locus_tag="B1761_00705"
/pseudo
CDS 123466..124223
/locus_tag="B1761_00705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014294590.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="phosphate ABC transporter ATP-binding protein"
gene 124251..124904
/locus_tag="B1761_00710"
CDS 124251..124904
/locus_tag="B1761_00710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002294804.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphate transport system regulatory protein
PhoU"
/protein_id="AQW34505.1"
gene 125038..127578
/locus_tag="B1761_00715"
CDS 125038..127578
/locus_tag="B1761_00715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534640.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminopeptidase"
/protein_id="AQW32976.1"
gene complement(127740..128810)
/locus_tag="B1761_00720"
CDS complement(127740..128810)
/locus_tag="B1761_00720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012658412.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tyrosine recombinase XerS"
/protein_id="AQW32977.1"
gene complement(129035..130024)
/locus_tag="B1761_00725"
CDS complement(129035..130024)
/locus_tag="B1761_00725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_007893175.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lipoate--protein ligase"
/protein_id="AQW32978.1"
gene 130207..130875
/locus_tag="B1761_00730"
CDS 130207..130875
/locus_tag="B1761_00730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608301.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32979.1"
gene 131036..131257
/locus_tag="B1761_00735"
CDS 131036..131257
/locus_tag="B1761_00735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950760.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34506.1"
gene complement(131363..133627)
/locus_tag="B1761_00740"
CDS complement(131363..133627)
/locus_tag="B1761_00740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608303.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="maltose phosphorylase"
/protein_id="AQW32980.1"
gene complement(133629..135137)
/locus_tag="B1761_00745"
CDS complement(133629..135137)
/locus_tag="B1761_00745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950762.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="4-alpha-glucanotransferase"
/protein_id="AQW32981.1"
gene complement(135334..135720)
/locus_tag="B1761_00750"
CDS complement(135334..135720)
/locus_tag="B1761_00750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727500.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LacI family transcriptional regulator"
/protein_id="AQW32982.1"
gene 135749..136036
/locus_tag="B1761_00755"
/pseudo
CDS 135749..136036
/locus_tag="B1761_00755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952942.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 136203..136301
/locus_tag="B1761_00760"
CDS 136203..136301
/locus_tag="B1761_00760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227213.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type I addiction module toxin, Fst family"
/protein_id="AQW34507.1"
gene complement(136440..136628)
/locus_tag="B1761_00765"
CDS complement(136440..136628)
/locus_tag="B1761_00765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534622.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Sec-independent protein translocase TatA"
/protein_id="AQW32983.1"
gene complement(136641..137369)
/locus_tag="B1761_00770"
CDS complement(136641..137369)
/locus_tag="B1761_00770"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621580.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="twin arginine-targeting protein translocase
TatC"
/protein_id="AQW32984.1"
gene complement(137356..139041)
/locus_tag="B1761_00775"
CDS complement(137356..139041)
/locus_tag="B1761_00775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884984.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="FTR1 family iron permease"
/protein_id="AQW32985.1"
gene complement(139019..140224)
/locus_tag="B1761_00780"
CDS complement(139019..140224)
/locus_tag="B1761_00780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002909774.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="deferrochelatase/peroxidase EfeB"
/protein_id="AQW32986.1"
gene complement(140230..141108)
/locus_tag="B1761_00785"
CDS complement(140230..141108)
/locus_tag="B1761_00785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534615.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="EfeM/EfeO family lipoprotein"
/protein_id="AQW32987.1"
gene complement(141359..141457)
/locus_tag="B1761_00790"
CDS complement(141359..141457)
/locus_tag="B1761_00790"
/inference="COORDINATES: protein motif:HMM:TIGR01167"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34508.1"
gene complement(141494..141763)
/locus_tag="B1761_00795"
CDS complement(141494..141763)
/locus_tag="B1761_00795"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608312.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amylopullulanase"
/protein_id="AQW32988.1"
gene complement(141869..142381)
/locus_tag="B1761_00800"
CDS complement(141869..142381)
/locus_tag="B1761_00800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608313.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amylopullulanase"
/protein_id="AQW32989.1"
gene complement(142445..142810)
/locus_tag="B1761_00805"
CDS complement(142445..142810)
/locus_tag="B1761_00805"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32990.1"
gene complement(142807..143238)
/locus_tag="B1761_00810"
CDS complement(142807..143238)
/locus_tag="B1761_00810"
/inference="COORDINATES: protein motif:HMM:PF00128.22"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32991.1"
gene complement(143456..143719)
/locus_tag="B1761_00815"
/pseudo
CDS complement(143456..143719)
/locus_tag="B1761_00815"
/inference="COORDINATES: protein motif:HMM:PF02922.16"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(144038..146967)
/locus_tag="B1761_00820"
/pseudo
CDS complement(144038..146967)
/locus_tag="B1761_00820"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634472.1"
/note="frameshifted; internal stop; incomplete; partial on
complete genome; missing stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="glycosyl hydrolase family 25"
gene complement(147243..148997)
/locus_tag="B1761_00825"
CDS complement(147243..148997)
/locus_tag="B1761_00825"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008089066.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydrolipoyl dehydrogenase"
/protein_id="AQW32992.1"
gene complement(149168..150556)
/locus_tag="B1761_00830"
CDS complement(149168..150556)
/locus_tag="B1761_00830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885106.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="iron ABC transporter ATP-binding protein"
/protein_id="AQW32993.1"
gene complement(150714..151712)
/locus_tag="B1761_00835"
CDS complement(150714..151712)
/locus_tag="B1761_00835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534608.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alpha-ketoacid dehydrogenase subunit beta"
/protein_id="AQW34509.1"
gene complement(151737..152708)
/locus_tag="B1761_00840"
CDS complement(151737..152708)
/locus_tag="B1761_00840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002989983.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pyruvate dehydrogenase"
/protein_id="AQW32994.1"
gene complement(153196..153531)
/locus_tag="B1761_00845"
CDS complement(153196..153531)
/locus_tag="B1761_00845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226003.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32995.1"
gene complement(153580..153765)
/locus_tag="B1761_00850"
CDS complement(153580..153765)
/locus_tag="B1761_00850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608317.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32996.1"
gene complement(153787..154230)
/locus_tag="B1761_00855"
CDS complement(153787..154230)
/locus_tag="B1761_00855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608318.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32997.1"
gene complement(154227..154406)
/locus_tag="B1761_00860"
CDS complement(154227..154406)
/locus_tag="B1761_00860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950821.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW32998.1"
gene complement(154494..155762)
/locus_tag="B1761_00865"
CDS complement(154494..155762)
/locus_tag="B1761_00865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226005.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydroorotase"
/protein_id="AQW32999.1"
gene complement(155782..156435)
/locus_tag="B1761_00870"
CDS complement(155782..156435)
/locus_tag="B1761_00870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950823.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="uracil-DNA glycosylase"
/protein_id="AQW33000.1"
gene 156649..157845
/locus_tag="B1761_00875"
CDS 156649..157845
/locus_tag="B1761_00875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950824.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cation-efflux pump"
/protein_id="AQW33001.1"
gene complement(158134..158985)
/locus_tag="B1761_00880"
CDS complement(158134..158985)
/locus_tag="B1761_00880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990642.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="patatin family protein"
/protein_id="AQW33002.1"
gene complement(158982..159440)
/locus_tag="B1761_00885"
CDS complement(158982..159440)
/locus_tag="B1761_00885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608322.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lysophospholipase"
/protein_id="AQW33003.1"
gene complement(159413..159604)
/locus_tag="B1761_00890"
CDS complement(159413..159604)
/locus_tag="B1761_00890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681157.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lipase"
/protein_id="AQW33004.1"
gene complement(159608..161185)
/locus_tag="B1761_00895"
CDS complement(159608..161185)
/locus_tag="B1761_00895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092663.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transporter"
/protein_id="AQW33005.1"
gene complement(161203..161481)
/locus_tag="B1761_00900"
CDS complement(161203..161481)
/locus_tag="B1761_00900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950837.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33006.1"
gene complement(161875..161967)
/locus_tag="B1761_00905"
/pseudo
CDS complement(161875..161967)
/locus_tag="B1761_00905"
/inference="COORDINATES: protein motif:HMM:PF00232.16"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="6-phospho-beta-glucosidase"
gene complement(161964..162782)
/locus_tag="B1761_00910"
CDS complement(161964..162782)
/locus_tag="B1761_00910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621610.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="6-phospho-beta-glucosidase"
/protein_id="AQW33007.1"
gene complement(162809..162997)
/locus_tag="B1761_00915"
CDS complement(162809..162997)
/locus_tag="B1761_00915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950839.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="6-phospho-beta-glucosidase"
/protein_id="AQW33008.1"
gene complement(163250..164386)
/locus_tag="B1761_00920"
CDS complement(163250..164386)
/locus_tag="B1761_00920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621613.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="AI-2E family transporter"
/protein_id="AQW33009.1"
gene complement(164465..165061)
/locus_tag="B1761_00925"
/pseudo
CDS complement(164465..165061)
/locus_tag="B1761_00925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990648.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="histidine phosphatase family protein"
gene complement(165058..165666)
/locus_tag="B1761_00930"
/pseudo
CDS complement(165058..165666)
/locus_tag="B1761_00930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634456.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="histidine phosphatase family protein"
gene complement(165663..166217)
/locus_tag="B1761_00935"
/pseudo
CDS complement(165663..166217)
/locus_tag="B1761_00935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003088384.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="histidine phosphatase family protein"
gene complement(166285..166965)
/locus_tag="B1761_00940"
CDS complement(166285..166965)
/locus_tag="B1761_00940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097119.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphatase"
/protein_id="AQW33010.1"
gene 167263..167838
/locus_tag="B1761_00945"
CDS 167263..167838
/locus_tag="B1761_00945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608329.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33011.1"
gene 168002..169257
/locus_tag="B1761_00950"
/pseudo
CDS 168002..169257
/locus_tag="B1761_00950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226023.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(169317..170303)
/locus_tag="B1761_00955"
CDS complement(169317..170303)
/locus_tag="B1761_00955"
/inference="COORDINATES: protein motif:HMM:PF00535.24"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33012.1"
gene complement(170296..170496)
/locus_tag="B1761_00960"
CDS complement(170296..170496)
/locus_tag="B1761_00960"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33013.1"
gene complement(170569..170703)
/locus_tag="B1761_00965"
/pseudo
CDS complement(170569..170703)
/locus_tag="B1761_00965"
/inference="COORDINATES: protein motif:HMM:PF00535.24"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="glycosyltransferase"
gene complement(170748..171842)
/locus_tag="B1761_00970"
CDS complement(170748..171842)
/locus_tag="B1761_00970"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33014.1"
gene complement(171848..172555)
/locus_tag="B1761_00975"
CDS complement(171848..172555)
/locus_tag="B1761_00975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002311297.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW33015.1"
gene complement(172552..173058)
/locus_tag="B1761_00980"
CDS complement(172552..173058)
/locus_tag="B1761_00980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000578434.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug MFS transporter"
/protein_id="AQW33016.1"
gene complement(173058..173507)
/locus_tag="B1761_00985"
CDS complement(173058..173507)
/locus_tag="B1761_00985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016174289.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylglucosamine--LPS N-acetylglucosamine
transferase"
/protein_id="AQW33017.1"
gene complement(173511..173999)
/locus_tag="B1761_00990"
/pseudo
CDS complement(173511..173999)
/locus_tag="B1761_00990"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012896992.1"
/note="internal stop; incomplete; partial on complete
genome; missing start; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="sugar transferase"
gene 174225..174485
/locus_tag="B1761_00995"
CDS 174225..174485
/locus_tag="B1761_00995"
/inference="COORDINATES: protein motif:HMM:PF01710.14"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33018.1"
gene 174482..175132
/locus_tag="B1761_01000"
/pseudo
CDS 174482..175132
/locus_tag="B1761_01000"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015081776.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene 175129..175335
/locus_tag="B1761_01005"
CDS 175129..175335
/locus_tag="B1761_01005"
/inference="COORDINATES: protein motif:HMM:PF13683.4"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33019.1"
gene complement(175538..176004)
/locus_tag="B1761_01010"
/pseudo
CDS complement(175538..176004)
/locus_tag="B1761_01010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002334572.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS6 family transposase"
gene 176476..177891
/locus_tag="B1761_01015"
CDS 176476..177891
/locus_tag="B1761_01015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003680632.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="flippase"
/protein_id="AQW33020.1"
gene complement(178253..179511)
/locus_tag="B1761_01020"
/pseudo
CDS complement(178253..179511)
/locus_tag="B1761_01020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006149780.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(179634..180617)
/locus_tag="B1761_01025"
CDS complement(179634..180617)
/locus_tag="B1761_01025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608343.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW33021.1"
gene complement(180614..180847)
/locus_tag="B1761_01030"
CDS complement(180614..180847)
/locus_tag="B1761_01030"
/inference="COORDINATES: protein motif:HMM:PF08759.9"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33022.1"
gene complement(180867..181007)
/locus_tag="B1761_01035"
/pseudo
CDS complement(180867..181007)
/locus_tag="B1761_01035"
/inference="COORDINATES: protein motif:HMM:PF08759.9"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(181084..181854)
/locus_tag="B1761_01040"
CDS complement(181084..181854)
/locus_tag="B1761_01040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014975122.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33023.1"
gene complement(181911..182187)
/locus_tag="B1761_01045"
/pseudo
CDS complement(181911..182187)
/locus_tag="B1761_01045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004909606.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene 182610..182918
/locus_tag="B1761_01050"
/pseudo
CDS 182610..182918
/locus_tag="B1761_01050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002343822.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS6 family transposase"
gene 182925..183215
/locus_tag="B1761_01055"
/pseudo
CDS 182925..183215
/locus_tag="B1761_01055"
/inference="COORDINATES: protein motif:HMM:PF13610.4"
/note="incomplete; partial on complete genome; missing
start and stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS6 family transposase"
gene complement(183333..183518)
/locus_tag="B1761_01060"
/pseudo
CDS complement(183333..183518)
/locus_tag="B1761_01060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003009075.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="glycosyltransferase"
gene complement(183552..184919)
/locus_tag="B1761_01065"
CDS complement(183552..184919)
/locus_tag="B1761_01065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681173.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="galactosyl transferase"
/protein_id="AQW33024.1"
gene complement(184976..185734)
/locus_tag="B1761_01070"
CDS complement(184976..185734)
/locus_tag="B1761_01070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727454.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tyrosine protein kinase"
/protein_id="AQW33025.1"
gene complement(185744..186436)
/locus_tag="B1761_01075"
CDS complement(185744..186436)
/locus_tag="B1761_01075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621639.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="capsular biosynthesis protein CpsC"
/protein_id="AQW33026.1"
gene complement(186445..187176)
/locus_tag="B1761_01080"
CDS complement(186445..187176)
/locus_tag="B1761_01080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226048.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tyrosine protein phosphatase"
/protein_id="AQW33027.1"
gene complement(187177..188637)
/locus_tag="B1761_01085"
CDS complement(187177..188637)
/locus_tag="B1761_01085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727451.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LytR family transcriptional regulator"
/protein_id="AQW33028.1"
gene complement(188973..189683)
/locus_tag="B1761_01090"
CDS complement(188973..189683)
/locus_tag="B1761_01090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000022098.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="purine-nucleoside phosphorylase"
/protein_id="AQW33029.1"
gene complement(190066..190745)
/locus_tag="B1761_01095"
/pseudo
CDS complement(190066..190745)
/locus_tag="B1761_01095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534543.1"
/note="Catalyzes the transfer of the ammonia group from
glutamine to a new carbon-nitrogen group; frameshifted;
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="GMP synthase"
gene complement(190746..191252)
/locus_tag="B1761_01100"
CDS complement(190746..191252)
/locus_tag="B1761_01100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608353.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33030.1"
gene complement(191256..191600)
/locus_tag="B1761_01105"
CDS complement(191256..191600)
/locus_tag="B1761_01105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608354.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chloride channel protein"
/protein_id="AQW33031.1"
gene complement(191959..192768)
/locus_tag="B1761_01110"
CDS complement(191959..192768)
/locus_tag="B1761_01110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016465664.1"
/note="catalyzes the formation of a purine and ribose
phosphate from a purine nucleoside; in E. coli this enzyme
functions in xanthosine degradation; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="purine-nucleoside phosphorylase"
/protein_id="AQW33032.1"
gene complement(192789..193327)
/locus_tag="B1761_01115"
/pseudo
CDS complement(192789..193327)
/locus_tag="B1761_01115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013903489.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="phosphopentomutase"
gene complement(193329..194540)
/locus_tag="B1761_01120"
CDS complement(193329..194540)
/locus_tag="B1761_01120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006151255.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphopentomutase"
/protein_id="AQW33033.1"
gene complement(194666..195346)
/locus_tag="B1761_01125"
CDS complement(194666..195346)
/locus_tag="B1761_01125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608358.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribose-5-phosphate isomerase"
/protein_id="AQW33034.1"
gene complement(195637..195894)
/locus_tag="B1761_01130"
CDS complement(195637..195894)
/locus_tag="B1761_01130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681181.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34510.1"
gene complement(196695..197009)
/locus_tag="B1761_01135"
CDS complement(196695..197009)
/locus_tag="B1761_01135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950878.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33035.1"
gene complement(197366..197950)
/locus_tag="B1761_01140"
CDS complement(197366..197950)
/locus_tag="B1761_01140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092921.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="uracil-DNA glycosylase"
/protein_id="AQW34511.1"
gene complement(197987..199393)
/locus_tag="B1761_01145"
CDS complement(197987..199393)
/locus_tag="B1761_01145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018374896.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dipeptidase PepV"
/protein_id="AQW33036.1"
gene 199623..199808
/locus_tag="B1761_01150"
CDS 199623..199808
/locus_tag="B1761_01150"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018375568.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="4-oxalocrotonate tautomerase"
/protein_id="AQW33037.1"
gene complement(199884..200357)
/locus_tag="B1761_01155"
CDS complement(199884..200357)
/locus_tag="B1761_01155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950887.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetyltransferase"
/protein_id="AQW33038.1"
gene complement(200722..200985)
/locus_tag="B1761_01160"
CDS complement(200722..200985)
/locus_tag="B1761_01160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951988.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS200/IS605 family transposase"
/protein_id="AQW33039.1"
gene complement(201149..201508)
/locus_tag="B1761_01165"
CDS complement(201149..201508)
/locus_tag="B1761_01165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019786714.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L20"
/protein_id="AQW33040.1"
gene complement(201565..201765)
/locus_tag="B1761_01170"
CDS complement(201565..201765)
/locus_tag="B1761_01170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001125942.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L35"
/protein_id="AQW33041.1"
gene complement(201804..202334)
/locus_tag="B1761_01175"
CDS complement(201804..202334)
/locus_tag="B1761_01175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226065.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="translation initiation factor IF-3"
/protein_id="AQW33042.1"
gene complement(202494..203174)
/locus_tag="B1761_01180"
CDS complement(202494..203174)
/locus_tag="B1761_01180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888812.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cytidylate kinase"
/protein_id="AQW33043.1"
gene complement(203195..203845)
/locus_tag="B1761_01185"
CDS complement(203195..203845)
/locus_tag="B1761_01185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226066.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidoglycan-binding protein LysM"
/protein_id="AQW33044.1"
gene 203891..204088
/locus_tag="B1761_01190"
CDS 203891..204088
/locus_tag="B1761_01190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681189.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ferredoxin"
/protein_id="AQW33045.1"
gene complement(204072..204572)
/locus_tag="B1761_01195"
CDS complement(204072..204572)
/locus_tag="B1761_01195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950909.1"
/note="Derived by automated computational analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="EbsA protein"
/protein_id="AQW33046.1"
gene complement(204629..205852)
/locus_tag="B1761_01200"
CDS complement(204629..205852)
/locus_tag="B1761_01200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888815.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase T"
/protein_id="AQW33047.1"
gene complement(206060..206617)
/locus_tag="B1761_01205"
CDS complement(206060..206617)
/locus_tag="B1761_01205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884860.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="signal peptidase I"
/protein_id="AQW33048.1"
gene complement(206740..207969)
/locus_tag="B1761_01210"
CDS complement(206740..207969)
/locus_tag="B1761_01210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953086.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33049.1"
gene complement(207959..209137)
/locus_tag="B1761_01215"
CDS complement(207959..209137)
/locus_tag="B1761_01215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227264.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="AI-2E family transporter"
/protein_id="AQW33050.1"
gene complement(209148..209630)
/locus_tag="B1761_01220"
CDS complement(209148..209630)
/locus_tag="B1761_01220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681193.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="7,8-dihydro-8-oxoguanine triphosphatase"
/protein_id="AQW33051.1"
gene complement(209786..210715)
/locus_tag="B1761_01225"
CDS complement(209786..210715)
/locus_tag="B1761_01225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092823.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW33052.1"
gene complement(210708..211400)
/locus_tag="B1761_01230"
CDS complement(210708..211400)
/locus_tag="B1761_01230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012678167.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division ATP-binding protein FtsE"
/protein_id="AQW34512.1"
gene complement(211488..212501)
/locus_tag="B1761_01235"
CDS complement(211488..212501)
/locus_tag="B1761_01235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018363957.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide chain release factor 2"
/protein_id="AQW33053.1"
gene complement(212639..213757)
/locus_tag="B1761_01240"
CDS complement(212639..213757)
/locus_tag="B1761_01240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092460.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="epoxyqueuosine reductase"
/protein_id="AQW33054.1"
gene 213851..214708
/locus_tag="B1761_01245"
CDS 213851..214708
/locus_tag="B1761_01245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890850.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoesterase"
/protein_id="AQW33055.1"
gene complement(214732..215478)
/locus_tag="B1761_01250"
CDS complement(214732..215478)
/locus_tag="B1761_01250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182603.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NADPH-dependent oxidoreductase"
/protein_id="AQW33056.1"
gene complement(215587..218271)
/locus_tag="B1761_01255"
CDS complement(215587..218271)
/locus_tag="B1761_01255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009854595.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATPase"
/protein_id="AQW33057.1"
gene complement(218537..218923)
/locus_tag="B1761_01260"
CDS complement(218537..218923)
/locus_tag="B1761_01260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884910.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33058.1"
gene complement(219015..219893)
/locus_tag="B1761_01265"
/pseudo
CDS complement(219015..219893)
/locus_tag="B1761_01265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003018247.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="GNAT family N-acetyltransferase"
gene 220101..220910
/locus_tag="B1761_01270"
CDS 220101..220910
/locus_tag="B1761_01270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019768805.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sugar-phosphatase"
/protein_id="AQW33059.1"
gene 220912..222126
/locus_tag="B1761_01275"
CDS 220912..222126
/locus_tag="B1761_01275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681202.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylmuramoylpentapeptide-lysine
N(6)-alanyltransferase"
/protein_id="AQW33060.1"
gene complement(222178..222539)
/locus_tag="B1761_01280"
/pseudo
CDS complement(222178..222539)
/locus_tag="B1761_01280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_005589492.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(222599..223411)
/locus_tag="B1761_01285"
CDS complement(222599..223411)
/locus_tag="B1761_01285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004227445.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MBL fold metallo-hydrolase"
/protein_id="AQW34513.1"
gene complement(223417..224757)
/locus_tag="B1761_01290"
CDS complement(223417..224757)
/locus_tag="B1761_01290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097035.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell wall metabolism sensor histidine kinase
VicK"
/protein_id="AQW33061.1"
gene complement(224750..225457)
/locus_tag="B1761_01295"
CDS complement(224750..225457)
/locus_tag="B1761_01295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014612100.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
/protein_id="AQW33062.1"
gene 225984..226751
/locus_tag="B1761_01300"
CDS 225984..226751
/locus_tag="B1761_01300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608372.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter"
/protein_id="AQW33063.1"
gene 226763..227596
/locus_tag="B1761_01305"
CDS 226763..227596
/locus_tag="B1761_01305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227276.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine ABC transporter substrate-binding
protein"
/protein_id="AQW33064.1"
gene 227614..228312
/locus_tag="B1761_01310"
CDS 227614..228312
/locus_tag="B1761_01310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886251.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine ABC transporter permease"
/protein_id="AQW33065.1"
gene 228324..228974
/locus_tag="B1761_01315"
CDS 228324..228974
/locus_tag="B1761_01315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003078567.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine ABC transporter permease"
/protein_id="AQW33066.1"
gene complement(229046..229927)
/locus_tag="B1761_01320"
CDS complement(229046..229927)
/locus_tag="B1761_01320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608376.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-entry nuclease"
/protein_id="AQW33067.1"
gene complement(229989..230177)
/locus_tag="B1761_01325"
CDS complement(229989..230177)
/locus_tag="B1761_01325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097027.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-directed RNA polymerase subunit beta"
/protein_id="AQW33068.1"
gene complement(230179..231450)
/locus_tag="B1761_01330"
CDS complement(230179..231450)
/locus_tag="B1761_01330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_041827046.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylglucosamine
1-carboxyvinyltransferase"
/protein_id="AQW33069.1"
gene complement(231520..231756)
/locus_tag="B1761_01335"
CDS complement(231520..231756)
/locus_tag="B1761_01335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890830.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33070.1"
gene complement(231944..232957)
/locus_tag="B1761_01340"
CDS complement(231944..232957)
/locus_tag="B1761_01340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227279.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-glucose 4-epimerase"
/protein_id="AQW33071.1"
gene complement(232972..234644)
/locus_tag="B1761_01345"
/pseudo
CDS complement(232972..234644)
/locus_tag="B1761_01345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890828.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(235044..236495)
/locus_tag="B1761_01350"
CDS complement(235044..236495)
/locus_tag="B1761_01350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883498.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33072.1"
gene complement(236495..237899)
/locus_tag="B1761_01355"
/pseudo
CDS complement(236495..237899)
/locus_tag="B1761_01355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681218.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
gene complement(237922..239748)
/locus_tag="B1761_01360"
CDS complement(237922..239748)
/locus_tag="B1761_01360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681219.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33073.1"
gene complement(239745..240659)
/locus_tag="B1761_01365"
CDS complement(239745..240659)
/locus_tag="B1761_01365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681220.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33074.1"
gene complement(240656..241558)
/locus_tag="B1761_01370"
CDS complement(240656..241558)
/locus_tag="B1761_01370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608384.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33075.1"
gene 241919..243176
/locus_tag="B1761_01375"
/pseudo
CDS 241919..243176
/locus_tag="B1761_01375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608187.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 243265..244440
/locus_tag="B1761_01380"
/pseudo
CDS 243265..244440
/locus_tag="B1761_01380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011675534.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS256 family transposase"
gene complement(244932..246125)
/locus_tag="B1761_01385"
CDS complement(244932..246125)
/locus_tag="B1761_01385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227281.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="S-adenosylmethionine synthase"
/protein_id="AQW33076.1"
gene 246405..247343
/locus_tag="B1761_01390"
CDS 246405..247343
/locus_tag="B1761_01390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002303340.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional biotin--[acetyl-CoA-carboxylase]
synthetase/biotin operon repressor"
/protein_id="AQW33077.1"
gene complement(247330..247515)
/locus_tag="B1761_01395"
CDS complement(247330..247515)
/locus_tag="B1761_01395"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883500.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33078.1"
gene complement(247742..249394)
/locus_tag="B1761_01400"
CDS complement(247742..249394)
/locus_tag="B1761_01400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634396.1"
/note="catalyzes the DNA-template-directed extension of
the 3'-end of a DNA strand; the tau chain serves as a
scaffold to help in the dimerizaton of the alpha,epsilon
and theta core complex; the gamma chain seems to interact
with the delta and delta' subunits to transfer the beta
subunit on the DNA; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase III subunit gamma/tau"
/protein_id="AQW33079.1"
gene complement(249394..249903)
/locus_tag="B1761_01405"
CDS complement(249394..249903)
/locus_tag="B1761_01405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990697.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GAF domain-containing protein"
/protein_id="AQW33080.1"
gene complement(249939..250838)
/locus_tag="B1761_01410"
CDS complement(249939..250838)
/locus_tag="B1761_01410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950920.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA dimethylallyltransferase"
/protein_id="AQW33081.1"
gene 250914..251090
/locus_tag="B1761_01415"
CDS 250914..251090
/locus_tag="B1761_01415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003000204.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF3042 domain-containing protein"
/protein_id="AQW33082.1"
gene 251142..251669
/locus_tag="B1761_01420"
CDS 251142..251669
/locus_tag="B1761_01420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681228.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33083.1"
gene complement(251787..252236)
/locus_tag="B1761_01425"
/pseudo
CDS complement(251787..252236)
/locus_tag="B1761_01425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016024477.1"
/note="internal stop; incomplete; partial on complete
genome; missing stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="DUF3102 domain-containing protein"
gene 252625..253131
/locus_tag="B1761_01430"
CDS 252625..253131
/locus_tag="B1761_01430"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33084.1"
gene 253220..254299
/locus_tag="B1761_01435"
CDS 253220..254299
/locus_tag="B1761_01435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015968524.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="site-specific integrase"
/protein_id="AQW33085.1"
gene complement(254311..254382)
/locus_tag="B1761_01440"
tRNA complement(254311..254382)
/locus_tag="B1761_01440"
/product="tRNA-Arg"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(254347..254349),aa:Arg,seq:cct)
gene complement(254433..254780)
/locus_tag="B1761_01445"
CDS complement(254433..254780)
/locus_tag="B1761_01445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_005590628.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L19"
/protein_id="AQW33086.1"
gene complement(254908..256134)
/locus_tag="B1761_01450"
/pseudo
CDS complement(254908..256134)
/locus_tag="B1761_01450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888082.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="voltage-gated chloride channel protein"
gene complement(256144..256416)
/locus_tag="B1761_01455"
CDS complement(256144..256416)
/locus_tag="B1761_01455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681230.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chorismate mutase"
/protein_id="AQW33087.1"
gene complement(256491..258026)
/locus_tag="B1761_01460"
CDS complement(256491..258026)
/locus_tag="B1761_01460"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883519.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ClC family H(+)/Cl(-) exchange transporter"
/protein_id="AQW33088.1"
gene complement(258077..258520)
/locus_tag="B1761_01465"
CDS complement(258077..258520)
/locus_tag="B1761_01465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883520.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="flavodoxin"
/protein_id="AQW33089.1"
gene complement(258749..258976)
/locus_tag="B1761_01470"
CDS complement(258749..258976)
/locus_tag="B1761_01470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226104.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33090.1"
gene complement(258988..259707)
/locus_tag="B1761_01475"
CDS complement(258988..259707)
/locus_tag="B1761_01475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890801.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Zn-dependent protease"
/protein_id="AQW33091.1"
gene complement(259827..260609)
/locus_tag="B1761_01480"
CDS complement(259827..260609)
/locus_tag="B1761_01480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950950.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetylesterase"
/protein_id="AQW33092.1"
gene complement(260734..262395)
/locus_tag="B1761_01485"
CDS complement(260734..262395)
/locus_tag="B1761_01485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006738720.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease J"
/protein_id="AQW33093.1"
gene complement(262577..263335)
/locus_tag="B1761_01490"
CDS complement(262577..263335)
/locus_tag="B1761_01490"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018363477.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphonate ABC transporter ATP-binding protein"
/protein_id="AQW33094.1"
gene complement(263332..264201)
/locus_tag="B1761_01495"
CDS complement(263332..264201)
/locus_tag="B1761_01495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003064298.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="branched-chain amino acid ABC transporter
permease"
/protein_id="AQW33095.1"
gene complement(264211..265212)
/locus_tag="B1761_01500"
CDS complement(264211..265212)
/locus_tag="B1761_01500"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888098.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter substrate-binding
protein"
/protein_id="AQW33096.1"
gene complement(265348..265569)
/locus_tag="B1761_01505"
CDS complement(265348..265569)
/locus_tag="B1761_01505"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990711.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF4649 domain-containing protein"
/protein_id="AQW33097.1"
gene complement(265771..265980)
/locus_tag="B1761_01510"
CDS complement(265771..265980)
/locus_tag="B1761_01510"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950963.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34514.1"
gene complement(266104..266460)
/locus_tag="B1761_01515"
CDS complement(266104..266460)
/locus_tag="B1761_01515"
/inference="COORDINATES: protein motif:HMM:TIGR04225"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33098.1"
gene complement(266558..266827)
/locus_tag="B1761_01520"
/pseudo
CDS complement(266558..266827)
/locus_tag="B1761_01520"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226111.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(266908..267359)
/locus_tag="B1761_01525"
/pseudo
CDS complement(266908..267359)
/locus_tag="B1761_01525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096991.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 267639..268814
/locus_tag="B1761_01530"
CDS 267639..268814
/locus_tag="B1761_01530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011675534.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS256 family transposase"
/protein_id="AQW33099.1"
gene complement(269132..269314)
/locus_tag="B1761_01535"
CDS complement(269132..269314)
/locus_tag="B1761_01535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092706.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33100.1"
gene 269453..270781
/locus_tag="B1761_01540"
CDS 269453..270781
/locus_tag="B1761_01540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607930.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
/protein_id="AQW33101.1"
gene complement(270865..272367)
/locus_tag="B1761_01545"
CDS complement(270865..272367)
/locus_tag="B1761_01545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019786583.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pyruvate kinase"
/protein_id="AQW33102.1"
gene complement(272437..273456)
/locus_tag="B1761_01550"
CDS complement(272437..273456)
/locus_tag="B1761_01550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681243.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-dependent 6-phosphofructokinase"
/protein_id="AQW33103.1"
gene complement(273549..276659)
/locus_tag="B1761_01555"
CDS complement(273549..276659)
/locus_tag="B1761_01555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950972.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase III subunit alpha"
/protein_id="AQW33104.1"
gene complement(276812..277597)
/locus_tag="B1761_01560"
CDS complement(276812..277597)
/locus_tag="B1761_01560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002276310.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="translation factor (SUA5)"
/protein_id="AQW33105.1"
gene complement(277694..278284)
/locus_tag="B1761_01565"
CDS complement(277694..278284)
/locus_tag="B1761_01565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002897735.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-isopropylmalate dehydratase small subunit"
/protein_id="AQW33106.1"
gene complement(278294..279676)
/locus_tag="B1761_01570"
CDS complement(278294..279676)
/locus_tag="B1761_01570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003011635.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-isopropylmalate dehydratase large subunit"
/protein_id="AQW33107.1"
gene complement(279707..279988)
/locus_tag="B1761_01575"
CDS complement(279707..279988)
/locus_tag="B1761_01575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950980.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33108.1"
gene complement(279993..281030)
/locus_tag="B1761_01580"
CDS complement(279993..281030)
/locus_tag="B1761_01580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004184057.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-isopropylmalate dehydrogenase"
/protein_id="AQW33109.1"
gene complement(281043..282605)
/locus_tag="B1761_01585"
CDS complement(281043..282605)
/locus_tag="B1761_01585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950987.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2-isopropylmalate synthase"
/protein_id="AQW33110.1"
gene complement(282953..283645)
/locus_tag="B1761_01590"
CDS complement(282953..283645)
/locus_tag="B1761_01590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006703946.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoglycerate mutase"
/protein_id="AQW33111.1"
gene 283900..284838
/locus_tag="B1761_01595"
CDS 283900..284838
/locus_tag="B1761_01595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608411.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydroorotate oxidase"
/protein_id="AQW33112.1"
gene complement(284902..285102)
/locus_tag="B1761_01600"
CDS complement(284902..285102)
/locus_tag="B1761_01600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681249.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33113.1"
gene complement(285161..285436)
/locus_tag="B1761_01605"
CDS complement(285161..285436)
/locus_tag="B1761_01605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950996.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein HU"
/protein_id="AQW33114.1"
gene complement(285573..286142)
/locus_tag="B1761_01610"
CDS complement(285573..286142)
/locus_tag="B1761_01610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226122.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33115.1"
gene complement(286135..287010)
/locus_tag="B1761_01615"
CDS complement(286135..287010)
/locus_tag="B1761_01615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096981.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GDSL family lipase"
/protein_id="AQW33116.1"
gene complement(287003..287839)
/locus_tag="B1761_01620"
CDS complement(287003..287839)
/locus_tag="B1761_01620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003063746.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="EDD domain protein"
/protein_id="AQW33117.1"
gene complement(287910..289580)
/locus_tag="B1761_01625"
CDS complement(287910..289580)
/locus_tag="B1761_01625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227293.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA repair protein RecN"
/protein_id="AQW33118.1"
gene complement(289589..290035)
/locus_tag="B1761_01630"
CDS complement(289589..290035)
/locus_tag="B1761_01630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990723.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ArgR family transcriptional regulator"
/protein_id="AQW33119.1"
gene complement(289983..290849)
/locus_tag="B1761_01635"
CDS complement(289983..290849)
/locus_tag="B1761_01635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226127.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="TlyA family rRNA
(cytidine-2'-O)-methyltransferase"
/protein_id="AQW33120.1"
gene complement(290842..291714)
/locus_tag="B1761_01640"
CDS complement(290842..291714)
/locus_tag="B1761_01640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681253.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="geranyl transferase"
/protein_id="AQW33121.1"
gene complement(291714..291929)
/locus_tag="B1761_01645"
CDS complement(291714..291929)
/locus_tag="B1761_01645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634320.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="exodeoxyribonuclease 7 small subunit"
/protein_id="AQW33122.1"
gene complement(291907..293247)
/locus_tag="B1761_01650"
CDS complement(291907..293247)
/locus_tag="B1761_01650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018365198.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="exodeoxyribonuclease VII large subunit"
/protein_id="AQW33123.1"
gene complement(293436..293681)
/locus_tag="B1761_01655"
CDS complement(293436..293681)
/locus_tag="B1761_01655"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226130.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33124.1"
gene complement(294333..294977)
/locus_tag="B1761_01660"
CDS complement(294333..294977)
/locus_tag="B1761_01660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990728.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="endonuclease III"
/protein_id="AQW33125.1"
gene complement(294977..295675)
/locus_tag="B1761_01665"
CDS complement(294977..295675)
/locus_tag="B1761_01665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990729.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA replication protein DnaD"
/protein_id="AQW33126.1"
gene complement(295747..296691)
/locus_tag="B1761_01670"
CDS complement(295747..296691)
/locus_tag="B1761_01670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226132.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="homoserine O-succinyltransferase"
/protein_id="AQW33127.1"
gene complement(296862..297380)
/locus_tag="B1761_01675"
CDS complement(296862..297380)
/locus_tag="B1761_01675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014294327.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="adenine phosphoribosyltransferase"
/protein_id="AQW33128.1"
gene complement(297495..299705)
/locus_tag="B1761_01680"
CDS complement(297495..299705)
/locus_tag="B1761_01680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681257.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="single-stranded-DNA-specific exonuclease RecJ"
/protein_id="AQW33129.1"
gene complement(299718..300485)
/locus_tag="B1761_01685"
CDS complement(299718..300485)
/locus_tag="B1761_01685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947209.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="short-chain dehydrogenase"
/protein_id="AQW33130.1"
gene complement(300485..301414)
/locus_tag="B1761_01690"
CDS complement(300485..301414)
/locus_tag="B1761_01690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890749.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease Z"
/protein_id="AQW33131.1"
gene complement(301446..302093)
/locus_tag="B1761_01695"
CDS complement(301446..302093)
/locus_tag="B1761_01695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634309.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cystathionine beta-lyase"
/protein_id="AQW33132.1"
gene complement(302086..303324)
/locus_tag="B1761_01700"
CDS complement(302086..303324)
/locus_tag="B1761_01700"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888940.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTPase HflX"
/protein_id="AQW33133.1"
gene complement(303444..304871)
/locus_tag="B1761_01705"
CDS complement(303444..304871)
/locus_tag="B1761_01705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884096.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="rod shape-determining protein RodA"
/protein_id="AQW33134.1"
gene complement(305367..305681)
/locus_tag="B1761_01710"
CDS complement(305367..305681)
/locus_tag="B1761_01710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990747.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosyl-ATP diphosphatase"
/protein_id="AQW33135.1"
gene complement(305690..306028)
/locus_tag="B1761_01715"
CDS complement(305690..306028)
/locus_tag="B1761_01715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634297.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosyl-AMP cyclohydrolase"
/protein_id="AQW33136.1"
gene complement(306025..306783)
/locus_tag="B1761_01720"
CDS complement(306025..306783)
/locus_tag="B1761_01720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681265.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="imidazole glycerol phosphate synthase cyclase
subunit"
/protein_id="AQW33137.1"
gene complement(306785..307504)
/locus_tag="B1761_01725"
CDS complement(306785..307504)
/locus_tag="B1761_01725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003087680.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="1-(5-phosphoribosyl)-5-((5-
phosphoribosylamino)methylideneamino)imidazole-4-
carboxamide isomerase"
/protein_id="AQW33138.1"
gene complement(307553..308161)
/locus_tag="B1761_01730"
CDS complement(307553..308161)
/locus_tag="B1761_01730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608421.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="imidazole glycerol phosphate synthase subunit
HisH"
/protein_id="AQW33139.1"
gene complement(308158..308742)
/gene="hisB"
/locus_tag="B1761_01735"
CDS complement(308158..308742)
/gene="hisB"
/locus_tag="B1761_01735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019789014.1"
/note="catalyzes the dehydration of
D-erythro-1-(imidazol-4-yl)glycerol 3-phosphate to
3-(imidazol-4-yl)-2-oxopropyl phosphate in histidine
biosynthesis; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="imidazoleglycerol-phosphate dehydratase"
/protein_id="AQW33140.1"
gene complement(308762..310045)
/locus_tag="B1761_01740"
CDS complement(308762..310045)
/locus_tag="B1761_01740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990750.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidinol dehydrogenase"
/protein_id="AQW33141.1"
gene complement(310042..310692)
/locus_tag="B1761_01745"
CDS complement(310042..310692)
/locus_tag="B1761_01745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681270.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP phosphoribosyltransferase"
/protein_id="AQW33142.1"
gene complement(310685..311665)
/locus_tag="B1761_01750"
CDS complement(310685..311665)
/locus_tag="B1761_01750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884011.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP phosphoribosyltransferase regulatory
subunit"
/protein_id="AQW33143.1"
gene complement(311662..312714)
/locus_tag="B1761_01755"
CDS complement(311662..312714)
/locus_tag="B1761_01755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681272.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidinol-phosphate transaminase"
/protein_id="AQW33144.1"
gene complement(313067..313267)
/locus_tag="B1761_01760"
CDS complement(313067..313267)
/locus_tag="B1761_01760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608426.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33145.1"
gene complement(313405..313893)
/locus_tag="B1761_01765"
CDS complement(313405..313893)
/locus_tag="B1761_01765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680582.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33146.1"
gene complement(313907..314248)
/locus_tag="B1761_01770"
CDS complement(313907..314248)
/locus_tag="B1761_01770"
/inference="COORDINATES: protein motif:HMM:PF13276.4"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33147.1"
gene complement(314224..314759)
/locus_tag="B1761_01775"
/pseudo
CDS complement(314224..314759)
/locus_tag="B1761_01775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948607.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(314836..315081)
/locus_tag="B1761_01780"
CDS complement(314836..315081)
/locus_tag="B1761_01780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884092.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CrcB family protein"
/protein_id="AQW33148.1"
gene complement(315156..315612)
/locus_tag="B1761_01785"
/pseudo
CDS complement(315156..315612)
/locus_tag="B1761_01785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093083.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="exopolysaccharide biosynthesis protein"
gene complement(315748..315954)
/locus_tag="B1761_01790"
CDS complement(315748..315954)
/locus_tag="B1761_01790"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608432.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="exopolysaccharide biosynthesis protein"
/protein_id="AQW34515.1"
gene complement(316051..316785)
/locus_tag="B1761_01795"
CDS complement(316051..316785)
/locus_tag="B1761_01795"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014835006.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34516.1"
gene complement(316794..317438)
/locus_tag="B1761_01800"
CDS complement(316794..317438)
/locus_tag="B1761_01800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951034.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33149.1"
gene complement(317428..318201)
/locus_tag="B1761_01805"
CDS complement(317428..318201)
/locus_tag="B1761_01805"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182688.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HAD family hydrolase"
/protein_id="AQW33150.1"
gene complement(318203..318946)
/locus_tag="B1761_01810"
CDS complement(318203..318946)
/locus_tag="B1761_01810"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888912.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acyl-[acyl-carrier-protein] thioesterase"
/protein_id="AQW33151.1"
gene complement(318947..320083)
/locus_tag="B1761_01815"
CDS complement(318947..320083)
/locus_tag="B1761_01815"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092450.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="coproporphyrinogen III oxidase"
/protein_id="AQW33152.1"
gene 320681..320935
/locus_tag="B1761_01820"
CDS 320681..320935
/locus_tag="B1761_01820"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227307.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33153.1"
gene complement(321050..321379)
/locus_tag="B1761_01825"
CDS complement(321050..321379)
/locus_tag="B1761_01825"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681284.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33154.1"
gene complement(321558..321817)
/locus_tag="B1761_01830"
/pseudo
CDS complement(321558..321817)
/locus_tag="B1761_01830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227309.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(321799..322050)
/locus_tag="B1761_01835"
CDS complement(321799..322050)
/locus_tag="B1761_01835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951057.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33155.1"
gene complement(322213..323259)
/locus_tag="B1761_01840"
CDS complement(322213..323259)
/locus_tag="B1761_01840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884100.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dTDP-glucose 4,6-dehydratase"
/protein_id="AQW33156.1"
gene complement(323688..324281)
/locus_tag="B1761_01845"
CDS complement(323688..324281)
/locus_tag="B1761_01845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018029578.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dTDP-4-dehydrorhamnose 3,5-epimerase"
/protein_id="AQW33157.1"
gene complement(324281..325150)
/locus_tag="B1761_01850"
CDS complement(324281..325150)
/locus_tag="B1761_01850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000676146.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glucose-1-phosphate thymidylyltransferase"
/protein_id="AQW33158.1"
gene complement(325382..326473)
/locus_tag="B1761_01855"
CDS complement(325382..326473)
/locus_tag="B1761_01855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951063.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="FAD-dependent oxidoreductase"
/protein_id="AQW33159.1"
gene complement(326540..327368)
/locus_tag="B1761_01860"
/pseudo
CDS complement(326540..327368)
/locus_tag="B1761_01860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009659387.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ZIP family metal transporter"
gene complement(327381..328169)
/locus_tag="B1761_01865"
CDS complement(327381..328169)
/locus_tag="B1761_01865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634275.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Nif3-like dinuclear metal center hexameric
protein"
/protein_id="AQW33160.1"
gene complement(328159..328845)
/locus_tag="B1761_01870"
CDS complement(328159..328845)
/locus_tag="B1761_01870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681288.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA (adenine-N(1))-methyltransferase"
/protein_id="AQW33161.1"
gene complement(328943..329383)
/locus_tag="B1761_01875"
CDS complement(328943..329383)
/locus_tag="B1761_01875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608439.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sugar translocase"
/protein_id="AQW33162.1"
gene complement(329386..330738)
/locus_tag="B1761_01880"
CDS complement(329386..330738)
/locus_tag="B1761_01880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008089571.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoglucosamine mutase"
/protein_id="AQW33163.1"
gene complement(330961..331926)
/locus_tag="B1761_01885"
CDS complement(330961..331926)
/locus_tag="B1761_01885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096921.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33164.1"
gene complement(331923..332774)
/locus_tag="B1761_01890"
CDS complement(331923..332774)
/locus_tag="B1761_01890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634271.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="TIGR00159 family protein"
/protein_id="AQW34517.1"
gene 332876..334219
/locus_tag="B1761_01895"
CDS 332876..334219
/locus_tag="B1761_01895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002960162.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylmuramyl peptide synthase"
/protein_id="AQW33165.1"
gene 334219..335007
/locus_tag="B1761_01900"
CDS 334219..335007
/locus_tag="B1761_01900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376678.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine amidotransferase"
/protein_id="AQW33166.1"
gene complement(335058..337613)
/locus_tag="B1761_01905"
CDS complement(335058..337613)
/locus_tag="B1761_01905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951086.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33167.1"
gene complement(337610..338329)
/locus_tag="B1761_01910"
CDS complement(337610..338329)
/locus_tag="B1761_01910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890691.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="oxidoreductase"
/protein_id="AQW33168.1"
gene complement(338517..338765)
/locus_tag="B1761_01915"
/pseudo
CDS complement(338517..338765)
/locus_tag="B1761_01915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_010773311.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(338855..340774)
/locus_tag="B1761_01920"
CDS complement(338855..340774)
/locus_tag="B1761_01920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608440.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW33169.1"
gene complement(340811..341446)
/locus_tag="B1761_01925"
CDS complement(340811..341446)
/locus_tag="B1761_01925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092587.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="uridine kinase"
/protein_id="AQW33170.1"
gene 341545..342627
/locus_tag="B1761_01930"
CDS 341545..342627
/locus_tag="B1761_01930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608441.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA helicase"
/protein_id="AQW33171.1"
gene complement(342586..342786)
/locus_tag="B1761_01935"
CDS complement(342586..342786)
/locus_tag="B1761_01935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951090.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33172.1"
gene complement(342916..344349)
/locus_tag="B1761_01940"
CDS complement(342916..344349)
/locus_tag="B1761_01940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951091.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NADP-dependent glyceraldehyde-3-phosphate
dehydrogenase"
/protein_id="AQW33173.1"
gene 344587..345915
/locus_tag="B1761_01945"
CDS 344587..345915
/locus_tag="B1761_01945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607930.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
/protein_id="AQW33174.1"
gene complement(345991..347724)
/locus_tag="B1761_01950"
CDS complement(345991..347724)
/locus_tag="B1761_01950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634263.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoenolpyruvate--protein phosphotransferase"
/protein_id="AQW33175.1"
gene complement(347729..347992)
/locus_tag="B1761_01955"
CDS complement(347729..347992)
/locus_tag="B1761_01955"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019775469.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphocarrier protein HPr"
/protein_id="AQW33176.1"
gene complement(348254..349429)
/locus_tag="B1761_01960"
CDS complement(348254..349429)
/locus_tag="B1761_01960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093026.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NADP-dependent isocitrate dehydrogenase"
/protein_id="AQW33177.1"
gene complement(349444..350568)
/locus_tag="B1761_01965"
CDS complement(349444..350568)
/locus_tag="B1761_01965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534297.1"
/note="catalyzes the formation of citrate from acetyl-CoA
and oxaloacetate; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="citrate synthase"
/protein_id="AQW33178.1"
gene complement(350570..353233)
/locus_tag="B1761_01970"
CDS complement(350570..353233)
/locus_tag="B1761_01970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681300.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aconitate hydratase"
/protein_id="AQW33179.1"
gene 353565..353789
/locus_tag="B1761_01975"
CDS 353565..353789
/locus_tag="B1761_01975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003082258.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NrdH-redoxin"
/protein_id="AQW33180.1"
gene 353876..356035
/locus_tag="B1761_01980"
CDS 353876..356035
/locus_tag="B1761_01980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000053857.1"
/note="Catalyzes the rate-limiting step in dNTP synthesis;
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonucleoside-diphosphate reductase subunit
alpha"
/protein_id="AQW33181.1"
gene 356195..357157
/locus_tag="B1761_01985"
CDS 356195..357157
/locus_tag="B1761_01985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092647.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="class 1b ribonucleoside-diphosphate reductase
subunit beta"
/protein_id="AQW33182.1"
gene 357509..357679
/locus_tag="B1761_01990"
CDS 357509..357679
/locus_tag="B1761_01990"
/inference="COORDINATES: protein motif:HMM:PF13542.4"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33183.1"
gene 357772..358236
/locus_tag="B1761_01995"
CDS 357772..358236
/locus_tag="B1761_01995"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608448.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS110 family transposase"
/protein_id="AQW33184.1"
gene 358325..358690
/locus_tag="B1761_02000"
CDS 358325..358690
/locus_tag="B1761_02000"
/inference="COORDINATES: protein motif:HMM:PF02371.14"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33185.1"
gene complement(358955..359923)
/locus_tag="B1761_02005"
CDS complement(358955..359923)
/locus_tag="B1761_02005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727578.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33186.1"
gene complement(360120..360437)
/locus_tag="B1761_02010"
CDS complement(360120..360437)
/locus_tag="B1761_02010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727579.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lactoylglutathione lyase"
/protein_id="AQW33187.1"
gene complement(360474..361235)
/locus_tag="B1761_02015"
CDS complement(360474..361235)
/locus_tag="B1761_02015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094436.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="class A sortase"
/protein_id="AQW33188.1"
gene complement(361268..363703)
/locus_tag="B1761_02020"
CDS complement(361268..363703)
/locus_tag="B1761_02020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006740209.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA gyrase subunit A"
/protein_id="AQW33189.1"
gene 363922..364908
/locus_tag="B1761_02025"
CDS 363922..364908
/locus_tag="B1761_02025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887868.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="L-lactate dehydrogenase"
/protein_id="AQW33190.1"
gene complement(365001..366374)
/locus_tag="B1761_02030"
CDS complement(365001..366374)
/locus_tag="B1761_02030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006739952.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NADH oxidase"
/protein_id="AQW33191.1"
gene complement(366690..368228)
/locus_tag="B1761_02035"
CDS complement(366690..368228)
/locus_tag="B1761_02035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681306.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="heme ABC transporter ATP-binding protein"
/protein_id="AQW33192.1"
gene complement(368322..368897)
/locus_tag="B1761_02040"
CDS complement(368322..368897)
/locus_tag="B1761_02040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608453.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33193.1"
gene complement(368887..369745)
/locus_tag="B1761_02045"
/pseudo
CDS complement(368887..369745)
/locus_tag="B1761_02045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096867.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="pyridoxamine kinase"
gene complement(369746..370255)
/locus_tag="B1761_02050"
CDS complement(369746..370255)
/locus_tag="B1761_02050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681308.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ECF transporter S component"
/protein_id="AQW33194.1"
gene complement(370393..370923)
/locus_tag="B1761_02055"
CDS complement(370393..370923)
/locus_tag="B1761_02055"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681309.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF5067 domain-containing protein"
/protein_id="AQW33195.1"
gene 371081..372346
/locus_tag="B1761_02060"
CDS 371081..372346
/locus_tag="B1761_02060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608454.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GntR family transcriptional regulator"
/protein_id="AQW33196.1"
gene complement(372390..372728)
/locus_tag="B1761_02065"
CDS complement(372390..372728)
/locus_tag="B1761_02065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018365984.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33197.1"
gene complement(372819..373124)
/locus_tag="B1761_02070"
CDS complement(372819..373124)
/locus_tag="B1761_02070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608456.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34518.1"
gene complement(373157..373393)
/locus_tag="B1761_02075"
CDS complement(373157..373393)
/locus_tag="B1761_02075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227328.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33198.1"
gene complement(373460..375868)
/locus_tag="B1761_02080"
CDS complement(373460..375868)
/locus_tag="B1761_02080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013642933.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phenylalanine--tRNA ligase subunit beta"
/protein_id="AQW34519.1"
gene complement(376169..376687)
/locus_tag="B1761_02085"
CDS complement(376169..376687)
/locus_tag="B1761_02085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534880.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetyltransferase"
/protein_id="AQW33199.1"
gene complement(376704..377747)
/locus_tag="B1761_02090"
CDS complement(376704..377747)
/locus_tag="B1761_02090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013642932.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phenylalanine--tRNA ligase subunit alpha"
/protein_id="AQW33200.1"
gene complement(377717..377953)
/locus_tag="B1761_02095"
CDS complement(377717..377953)
/locus_tag="B1761_02095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951136.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33201.1"
gene complement(378367..381900)
/locus_tag="B1761_02100"
CDS complement(378367..381900)
/locus_tag="B1761_02100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096852.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chromosome segregation protein SMC"
/protein_id="AQW33202.1"
gene complement(381903..382592)
/locus_tag="B1761_02105"
CDS complement(381903..382592)
/locus_tag="B1761_02105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182345.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease 3"
/protein_id="AQW33203.1"
gene complement(382749..383684)
/locus_tag="B1761_02110"
CDS complement(382749..383684)
/locus_tag="B1761_02110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002935444.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="4-hydroxy-tetrahydrodipicolinate synthase"
/protein_id="AQW33204.1"
gene complement(384022..385098)
/locus_tag="B1761_02115"
CDS complement(384022..385098)
/locus_tag="B1761_02115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000542485.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartate-semialdehyde dehydrogenase"
/protein_id="AQW33205.1"
gene complement(385265..385459)
/locus_tag="B1761_02120"
/pseudo
CDS complement(385265..385459)
/locus_tag="B1761_02120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951147.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="DNA alkylation repair protein"
gene complement(385459..385971)
/locus_tag="B1761_02125"
CDS complement(385459..385971)
/locus_tag="B1761_02125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727584.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetyltransferase"
/protein_id="AQW33206.1"
gene 386309..386938
/locus_tag="B1761_02130"
/pseudo
CDS 386309..386938
/locus_tag="B1761_02130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002296233.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(387022..388473)
/locus_tag="B1761_02135"
CDS complement(387022..388473)
/locus_tag="B1761_02135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227335.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cardiolipin synthase"
/protein_id="AQW33207.1"
gene complement(388661..390448)
/locus_tag="B1761_02140"
CDS complement(388661..390448)
/locus_tag="B1761_02140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951169.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="excinuclease ABC subunit C"
/protein_id="AQW33208.1"
gene complement(390508..391203)
/locus_tag="B1761_02145"
CDS complement(390508..391203)
/locus_tag="B1761_02145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608464.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="noncanonical pyrimidine nucleotidase, YjjG
family"
/protein_id="AQW33209.1"
gene 391394..391936
/locus_tag="B1761_02150"
CDS 391394..391936
/locus_tag="B1761_02150"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608465.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="BioY family transporter"
/protein_id="AQW33210.1"
gene complement(392170..392796)
/locus_tag="B1761_02155"
CDS complement(392170..392796)
/locus_tag="B1761_02155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948550.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycine/betaine ABC transporter permease"
/protein_id="AQW33211.1"
gene complement(392801..393556)
/locus_tag="B1761_02160"
CDS complement(392801..393556)
/locus_tag="B1761_02160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948547.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycine/betaine ABC transporter ATP-binding
protein"
/protein_id="AQW33212.1"
gene complement(393568..394485)
/locus_tag="B1761_02165"
CDS complement(393568..394485)
/locus_tag="B1761_02165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948546.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycine/betaine ABC transporter
substrate-binding protein"
/protein_id="AQW33213.1"
gene complement(394482..395138)
/locus_tag="B1761_02170"
CDS complement(394482..395138)
/locus_tag="B1761_02170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014294714.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycine/betaine ABC transporter permease"
/protein_id="AQW34520.1"
gene complement(395198..396694)
/locus_tag="B1761_02175"
CDS complement(395198..396694)
/locus_tag="B1761_02175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608469.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidine ammonia-lyase"
/protein_id="AQW33214.1"
gene complement(396717..397820)
/locus_tag="B1761_02180"
CDS complement(396717..397820)
/locus_tag="B1761_02180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226202.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33215.1"
gene complement(397837..399471)
/locus_tag="B1761_02185"
CDS complement(397837..399471)
/locus_tag="B1761_02185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608471.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="urocanate hydratase"
/protein_id="AQW33216.1"
gene 399958..400314
/locus_tag="B1761_02190"
/pseudo
CDS 399958..400314
/locus_tag="B1761_02190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681325.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="serine dehydratase"
gene complement(400383..400985)
/locus_tag="B1761_02195"
CDS complement(400383..400985)
/locus_tag="B1761_02195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226213.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
/protein_id="AQW33217.1"
gene complement(400982..402076)
/locus_tag="B1761_02200"
CDS complement(400982..402076)
/locus_tag="B1761_02200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094752.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sensor histidine kinase"
/protein_id="AQW33218.1"
gene complement(402069..402806)
/locus_tag="B1761_02205"
CDS complement(402069..402806)
/locus_tag="B1761_02205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681332.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter"
/protein_id="AQW33219.1"
gene complement(402803..403684)
/locus_tag="B1761_02210"
CDS complement(402803..403684)
/locus_tag="B1761_02210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727601.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW33220.1"
gene complement(403677..403856)
/locus_tag="B1761_02215"
CDS complement(403677..403856)
/locus_tag="B1761_02215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681334.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33221.1"
gene complement(403867..404076)
/locus_tag="B1761_02220"
CDS complement(403867..404076)
/locus_tag="B1761_02220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887935.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33222.1"
gene complement(404229..405167)
/locus_tag="B1761_02225"
CDS complement(404229..405167)
/locus_tag="B1761_02225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002282088.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="symporter"
/protein_id="AQW33223.1"
gene complement(405312..405761)
/locus_tag="B1761_02230"
CDS complement(405312..405761)
/locus_tag="B1761_02230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227350.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cytidine deaminase"
/protein_id="AQW33224.1"
gene complement(405855..406508)
/locus_tag="B1761_02235"
CDS complement(405855..406508)
/locus_tag="B1761_02235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608479.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter"
/protein_id="AQW33225.1"
gene complement(406505..407386)
/locus_tag="B1761_02240"
CDS complement(406505..407386)
/locus_tag="B1761_02240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727601.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW33226.1"
gene complement(407457..408134)
/locus_tag="B1761_02245"
CDS complement(407457..408134)
/locus_tag="B1761_02245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621751.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33227.1"
gene complement(408274..408939)
/locus_tag="B1761_02250"
CDS complement(408274..408939)
/locus_tag="B1761_02250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681344.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33228.1"
gene complement(408926..409447)
/locus_tag="B1761_02255"
CDS complement(408926..409447)
/locus_tag="B1761_02255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681345.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="zinc/iron-chelating domain-containing protein"
/protein_id="AQW33229.1"
gene complement(409532..411532)
/locus_tag="B1761_02260"
CDS complement(409532..411532)
/locus_tag="B1761_02260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621753.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter permease"
/protein_id="AQW33230.1"
gene complement(411534..412292)
/locus_tag="B1761_02265"
CDS complement(411534..412292)
/locus_tag="B1761_02265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227353.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin ABC transporter ATP-binding protein"
/protein_id="AQW33231.1"
gene complement(412437..413408)
/locus_tag="B1761_02270"
CDS complement(412437..413408)
/locus_tag="B1761_02270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681348.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-binding protein"
/protein_id="AQW34521.1"
gene complement(413401..414081)
/locus_tag="B1761_02275"
CDS complement(413401..414081)
/locus_tag="B1761_02275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226224.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
/protein_id="AQW33232.1"
regulatory 414286..414381
/regulatory_class="riboswitch"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00167"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="purine riboswitch; Derived by automated
computational analysis using gene prediction method:
cmsearch."
/bound_moiety="guanine and/or adenine"
/db_xref="RFAM:RF00167"
gene 414532..415112 /locus_tag="B1761_02280"
/pseudo
CDS 414532..415112
/locus_tag="B1761_02280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000770426.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="xanthine phosphoribosyltransferase"
gene 415201..415653
/locus_tag="B1761_02285"
CDS 415201..415653
/locus_tag="B1761_02285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608486.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="xanthine permease"
/protein_id="AQW33233.1"
gene 415675..416379
/locus_tag="B1761_02290"
CDS 415675..416379
/locus_tag="B1761_02290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608487.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="xanthine permease"
/protein_id="AQW33234.1"
gene 416507..417856
/locus_tag="B1761_02295"
CDS 416507..417856
/locus_tag="B1761_02295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227359.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MATE family efflux transporter"
/protein_id="AQW33235.1"
gene complement(418221..419171)
/locus_tag="B1761_02300"
CDS complement(418221..419171)
/locus_tag="B1761_02300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951292.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide-methionine (R)-S-oxide reductase"
/protein_id="AQW33236.1"
gene complement(419308..420636)
/locus_tag="B1761_02305"
CDS complement(419308..420636)
/locus_tag="B1761_02305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534956.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="branched-chain amino acid transport system II
carrier protein"
/protein_id="AQW33237.1"
gene complement(420850..421558)
/locus_tag="B1761_02310"
/pseudo
CDS complement(420850..421558)
/locus_tag="B1761_02310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001811894.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="mannose-6-phosphate isomerase, class I"
gene 421549..421626
/locus_tag="B1761_02315"
/pseudo
CDS 421549..421626
/locus_tag="B1761_02315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634702.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="DUF421 domain-containing protein"
gene 421694..421888
/locus_tag="B1761_02320"
CDS 421694..421888
/locus_tag="B1761_02320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182295.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CsbD family protein"
/protein_id="AQW33238.1"
gene complement(421955..422157)
/locus_tag="B1761_02325"
/pseudo
CDS complement(421955..422157)
/locus_tag="B1761_02325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534960.1"
/note="frameshifted; internal stop; incomplete; partial on
complete genome; missing start; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(422759..424144)
/locus_tag="B1761_02330"
CDS complement(422759..424144)
/locus_tag="B1761_02330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634706.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid permease"
/protein_id="AQW33239.1"
gene complement(424570..425172)
/locus_tag="B1761_02335"
CDS complement(424570..425172)
/locus_tag="B1761_02335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227375.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nitroreductase"
/protein_id="AQW33240.1"
gene complement(425310..426170)
/locus_tag="B1761_02340"
CDS complement(425310..426170)
/locus_tag="B1761_02340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608494.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glyoxalase"
/protein_id="AQW33241.1"
gene complement(426305..426754)
/locus_tag="B1761_02345"
CDS complement(426305..426754)
/locus_tag="B1761_02345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951313.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33242.1"
gene complement(426936..427799)
/locus_tag="B1761_02350"
CDS complement(426936..427799)
/locus_tag="B1761_02350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951315.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acyltransferase"
/protein_id="AQW33243.1"
gene complement(427786..429078)
/locus_tag="B1761_02355"
CDS complement(427786..429078)
/locus_tag="B1761_02355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681358.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PTS fructose transporter subunit IIA"
/protein_id="AQW33244.1"
gene complement(429267..429899)
/locus_tag="B1761_02360"
CDS complement(429267..429899)
/locus_tag="B1761_02360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608498.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nitroreductase family protein"
/protein_id="AQW33245.1"
gene complement(429992..430588)
/locus_tag="B1761_02365"
CDS complement(429992..430588)
/locus_tag="B1761_02365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227378.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF1275 family protein"
/protein_id="AQW33246.1"
gene complement(430744..431586)
/locus_tag="B1761_02370"
CDS complement(430744..431586)
/locus_tag="B1761_02370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006363846.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2,5-diketo-D-gluconic acid reductase"
/protein_id="AQW33247.1"
gene complement(431719..432719)
/locus_tag="B1761_02375"
/pseudo
CDS complement(431719..432719)
/locus_tag="B1761_02375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002295140.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="UDP-glucose 4-epimerase GalE"
gene 433056..434540
/locus_tag="B1761_02380"
CDS 433056..434540
/locus_tag="B1761_02380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535024.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33248.1"
gene complement(434760..435104)
/locus_tag="B1761_02385"
CDS complement(434760..435104)
/locus_tag="B1761_02385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885337.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33249.1"
gene 435364..435627
/locus_tag="B1761_02390"
CDS 435364..435627
/locus_tag="B1761_02390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951330.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33250.1"
gene complement(435817..436470)
/locus_tag="B1761_02395"
/pseudo
CDS complement(435817..436470)
/locus_tag="B1761_02395"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_007522722.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
gene complement(436550..437005)
/locus_tag="B1761_02400"
CDS complement(436550..437005)
/locus_tag="B1761_02400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727608.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell wall surface anchor protein"
/protein_id="AQW33251.1"
gene 437050..437262
/locus_tag="B1761_02405"
CDS 437050..437262
/locus_tag="B1761_02405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002944144.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33252.1"
gene complement(437308..437667)
/locus_tag="B1761_02410"
CDS complement(437308..437667)
/locus_tag="B1761_02410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727609.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33253.1"
gene complement(437664..439079)
/locus_tag="B1761_02415"
CDS complement(437664..439079)
/locus_tag="B1761_02415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_005590087.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase"
/protein_id="AQW33254.1"
gene complement(439252..440289)
/locus_tag="B1761_02420"
CDS complement(439252..440289)
/locus_tag="B1761_02420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608505.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33255.1"
gene 440527..440814
/locus_tag="B1761_02425"
CDS 440527..440814
/locus_tag="B1761_02425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226258.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33256.1"
gene 441063..441311
/locus_tag="B1761_02430"
CDS 441063..441311
/locus_tag="B1761_02430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226259.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33257.1"
gene 441522..442139
/locus_tag="B1761_02435"
CDS 441522..442139
/locus_tag="B1761_02435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226260.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="threonine transporter RhtB"
/protein_id="AQW33258.1"
gene complement(442480..442839)
/locus_tag="B1761_02440"
CDS complement(442480..442839)
/locus_tag="B1761_02440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226262.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33259.1"
gene complement(443069..443267)
/locus_tag="B1761_02445"
/pseudo
CDS complement(443069..443267)
/locus_tag="B1761_02445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621774.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(443398..445491)
/locus_tag="B1761_02450"
CDS complement(443398..445491)
/locus_tag="B1761_02450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227391.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW33260.1"
gene 446139..447185
/locus_tag="B1761_02455"
CDS 446139..447185
/locus_tag="B1761_02455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608508.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW33261.1"
gene 447190..447863
/locus_tag="B1761_02460"
/pseudo
CDS 447190..447863
/locus_tag="B1761_02460"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681376.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
gene 448263..448436
/locus_tag="B1761_02465"
CDS 448263..448436
/locus_tag="B1761_02465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681377.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33262.1"
gene 448606..448875
/locus_tag="B1761_02470"
CDS 448606..448875
/locus_tag="B1761_02470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681378.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33263.1"
gene 449035..449334
/locus_tag="B1761_02475"
CDS 449035..449334
/locus_tag="B1761_02475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947960.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33264.1"
gene complement(449434..450345)
/locus_tag="B1761_02480"
CDS complement(449434..450345)
/locus_tag="B1761_02480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681380.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sodium transporter"
/protein_id="AQW33265.1"
gene complement(450342..450664)
/locus_tag="B1761_02485"
/pseudo
CDS complement(450342..450664)
/locus_tag="B1761_02485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018029430.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(450661..451287)
/locus_tag="B1761_02490"
/pseudo
CDS complement(450661..451287)
/locus_tag="B1761_02490"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012678617.1"
/note="internal stop; incomplete; partial on complete
genome; missing start; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="coenzyme PQQ synthesis protein"
gene complement(451357..452448)
/locus_tag="B1761_02495"
CDS complement(451357..452448)
/locus_tag="B1761_02495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681382.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transporter"
/protein_id="AQW33266.1"
gene complement(452445..453764)
/locus_tag="B1761_02500"
CDS complement(452445..453764)
/locus_tag="B1761_02500"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621777.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="KxxxW cyclic peptide radical SAM maturase"
/protein_id="AQW33267.1"
gene complement(453834..453926)
/locus_tag="B1761_02505"
CDS complement(453834..453926)
/locus_tag="B1761_02505"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681384.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="KxxxW-cyclized peptide pheromone"
/protein_id="AQW33268.1"
gene complement(454009..454869)
/locus_tag="B1761_02510"
CDS complement(454009..454869)
/locus_tag="B1761_02510"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681385.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MutR family transcriptional regulator"
/protein_id="AQW33269.1"
gene complement(455109..455945)
/locus_tag="B1761_02515"
CDS complement(455109..455945)
/locus_tag="B1761_02515"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002263573.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33270.1"
gene complement(455939..456448)
/locus_tag="B1761_02520"
CDS complement(455939..456448)
/locus_tag="B1761_02520"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681387.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW34522.1"
gene complement(456995..457612)
/locus_tag="B1761_02525"
CDS complement(456995..457612)
/locus_tag="B1761_02525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014623243.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidylprolyl isomerase"
/protein_id="AQW33271.1"
gene complement(457907..461086)
/locus_tag="B1761_02530"
CDS complement(457907..461086)
/locus_tag="B1761_02530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634788.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-dependent dsDNA exonuclease"
/protein_id="AQW33272.1"
gene complement(461083..462291)
/locus_tag="B1761_02535"
CDS complement(461083..462291)
/locus_tag="B1761_02535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182188.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="exonuclease sbcCD subunit D"
/protein_id="AQW33273.1"
gene complement(462466..462564)
/locus_tag="B1761_02540"
/pseudo
CDS complement(462466..462564)
/locus_tag="B1761_02540"
/inference="COORDINATES: protein motif:HMM:PF13333.4"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(463146..466226)
/locus_tag="B1761_02545"
CDS complement(463146..466226)
/locus_tag="B1761_02545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226267.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="beta-galactosidase"
/protein_id="AQW33274.1"
gene complement(466230..468134)
/locus_tag="B1761_02550"
CDS complement(466230..468134)
/locus_tag="B1761_02550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608519.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lactose permease"
/protein_id="AQW33275.1"
gene complement(468237..469283)
/locus_tag="B1761_02555"
CDS complement(468237..469283)
/locus_tag="B1761_02555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226269.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="galactose mutarotase"
/protein_id="AQW33276.1"
gene complement(469353..470354)
/locus_tag="B1761_02560"
CDS complement(469353..470354)
/locus_tag="B1761_02560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018374997.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-glucose 4-epimerase GalE"
/protein_id="AQW33277.1"
gene complement(470384..471865)
/locus_tag="B1761_02565"
CDS complement(470384..471865)
/locus_tag="B1761_02565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621782.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="galactose-1-phosphate uridylyltransferase"
/protein_id="AQW34523.1"
gene complement(471885..473051)
/locus_tag="B1761_02570"
CDS complement(471885..473051)
/locus_tag="B1761_02570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003019003.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="galactokinase"
/protein_id="AQW33278.1"
gene 473194..474189
/locus_tag="B1761_02575"
CDS 473194..474189
/locus_tag="B1761_02575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226273.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33279.1"
gene complement(474669..475026)
/locus_tag="B1761_02580"
/pseudo
CDS complement(474669..475026)
/locus_tag="B1761_02580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680582.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(474984..475172)
/locus_tag="B1761_02585"
CDS complement(474984..475172)
/locus_tag="B1761_02585"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33280.1"
gene complement(475345..476667)
/locus_tag="B1761_02590"
CDS complement(475345..476667)
/locus_tag="B1761_02590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608523.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="metalloendopeptidase"
/protein_id="AQW33281.1"
gene complement(476681..476839)
/locus_tag="B1761_02595"
CDS complement(476681..476839)
/locus_tag="B1761_02595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951368.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33282.1"
gene complement(476876..477118)
/locus_tag="B1761_02600"
/pseudo
CDS complement(476876..477118)
/locus_tag="B1761_02600"
/inference="COORDINATES: protein motif:HMM:PF07580.12"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 477315..477596
/locus_tag="B1761_02605"
CDS 477315..477596
/locus_tag="B1761_02605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951370.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW33283.1"
gene complement(477651..478244)
/locus_tag="B1761_02610"
/pseudo
CDS complement(477651..478244)
/locus_tag="B1761_02610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634796.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ABC transporter"
gene complement(478251..478441)
/locus_tag="B1761_02615"
/pseudo
CDS complement(478251..478441)
/locus_tag="B1761_02615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951377.1"
/note="frameshifted; incomplete; partial on complete
genome; missing stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ABC transporter ATPase"
gene 479193..481457
/locus_tag="B1761_02620"
CDS 479193..481457
/locus_tag="B1761_02620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608527.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional glutamate--cysteine
ligase/glutathione synthetase"
/protein_id="AQW33284.1"
gene 481559..482074
/locus_tag="B1761_02625"
/pseudo
CDS 481559..482074
/locus_tag="B1761_02625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990956.1"
/note="incomplete; partial on complete genome; missing
start and stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(482046..484088)
/locus_tag="B1761_02630"
/pseudo
CDS complement(482046..484088)
/locus_tag="B1761_02630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003060669.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="type I pullulanase"
gene complement(484299..486713)
/locus_tag="B1761_02635"
CDS complement(484299..486713)
/locus_tag="B1761_02635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891412.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein FtsK"
/protein_id="AQW33285.1"
gene complement(486866..487864)
/locus_tag="B1761_02640"
CDS complement(486866..487864)
/locus_tag="B1761_02640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019777885.1"
/note="catalyzes the oxidation of ferredoxin with NADP;
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ferredoxin--NADP(+) reductase"
/protein_id="AQW33286.1"
gene complement(487866..488585)
/locus_tag="B1761_02645"
CDS complement(487866..488585)
/locus_tag="B1761_02645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951382.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA (guanosine(37)-N1)-methyltransferase TrmD"
/protein_id="AQW33287.1"
gene complement(488575..489093)
/locus_tag="B1761_02650"
CDS complement(488575..489093)
/locus_tag="B1761_02650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018029943.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosome maturation factor RimM"
/protein_id="AQW33288.1"
gene complement(489309..489380)
/locus_tag="B1761_02655"
tRNA complement(489309..489380)
/locus_tag="B1761_02655"
/product="tRNA-Glu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(489345..489347),aa:Glu,seq:ttc)
gene complement(489410..489481)
/locus_tag="B1761_02660"
tRNA complement(489410..489481)
/locus_tag="B1761_02660"
/product="tRNA-Gln"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(489447..489449),aa:Gln,seq:ttg)
gene complement(489764..490408)
/locus_tag="B1761_02665"
CDS complement(489764..490408)
/locus_tag="B1761_02665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951384.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
/protein_id="AQW33289.1"
gene complement(490398..491408)
/locus_tag="B1761_02670"
CDS complement(490398..491408)
/locus_tag="B1761_02670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093548.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="two-component sensor histidine kinase"
/protein_id="AQW33290.1"
gene complement(491405..492103)
/locus_tag="B1761_02675"
CDS complement(491405..492103)
/locus_tag="B1761_02675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634809.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transporter"
/protein_id="AQW33291.1"
gene complement(492257..492876)
/locus_tag="B1761_02680"
/pseudo
CDS complement(492257..492876)
/locus_tag="B1761_02680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096616.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="Ion channel protein"
gene complement(493162..495033)
/locus_tag="B1761_02685"
CDS complement(493162..495033)
/locus_tag="B1761_02685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621795.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine/threonine protein kinase"
/protein_id="AQW33292.1"
gene complement(495033..495770)
/locus_tag="B1761_02690"
CDS complement(495033..495770)
/locus_tag="B1761_02690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886859.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="protein phosphatase"
/protein_id="AQW33293.1"
gene complement(495814..497136)
/locus_tag="B1761_02695"
CDS complement(495814..497136)
/locus_tag="B1761_02695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946882.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="16S rRNA (cytosine(967)-C(5))-methyltransferase"
/protein_id="AQW34524.1"
gene complement(497126..498061)
/locus_tag="B1761_02700"
CDS complement(497126..498061)
/locus_tag="B1761_02700"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889386.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="methionyl-tRNA formyltransferase"
/protein_id="AQW33294.1"
gene complement(498079..500475)
/locus_tag="B1761_02705"
CDS complement(498079..500475)
/locus_tag="B1761_02705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990233.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="primosomal protein N'"
/protein_id="AQW33295.1"
gene complement(500617..500931)
/locus_tag="B1761_02710"
CDS complement(500617..500931)
/locus_tag="B1761_02710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003018070.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-directed RNA polymerase subunit omega"
/protein_id="AQW33296.1"
gene complement(500953..501582)
/locus_tag="B1761_02715"
CDS complement(500953..501582)
/locus_tag="B1761_02715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886854.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="guanylate kinase"
/protein_id="AQW33297.1"
gene complement(501808..503199)
/locus_tag="B1761_02720"
CDS complement(501808..503199)
/locus_tag="B1761_02720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727617.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="signal recognition particle-docking protein
FtsY"
/protein_id="AQW33298.1"
gene complement(503213..504028)
/locus_tag="B1761_02725"
CDS complement(503213..504028)
/locus_tag="B1761_02725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951420.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="haloacid dehalogenase"
/protein_id="AQW33299.1"
gene complement(504021..504815)
/locus_tag="B1761_02730"
CDS complement(504021..504815)
/locus_tag="B1761_02730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227406.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HAD family hydrolase"
/protein_id="AQW33300.1"
gene 504999..505376
/locus_tag="B1761_02735"
CDS 504999..505376
/locus_tag="B1761_02735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886850.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GntR family transcriptional regulator"
/protein_id="AQW33301.1"
gene 505381..506079
/locus_tag="B1761_02740"
CDS 505381..506079
/locus_tag="B1761_02740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094313.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter"
/protein_id="AQW33302.1"
gene 506091..506876
/locus_tag="B1761_02745"
CDS 506091..506876
/locus_tag="B1761_02745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951425.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW33303.1"
gene complement(506926..507855)
/locus_tag="B1761_02750"
CDS complement(506926..507855)
/locus_tag="B1761_02750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951426.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW33304.1"
gene complement(507848..508933)
/locus_tag="B1761_02755"
CDS complement(507848..508933)
/locus_tag="B1761_02755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990226.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW33305.1"
gene complement(508943..509869)
/locus_tag="B1761_02760"
CDS complement(508943..509869)
/locus_tag="B1761_02760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009569326.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter permease"
/protein_id="AQW33306.1"
gene complement(509869..511362)
/locus_tag="B1761_02765"
CDS complement(509869..511362)
/locus_tag="B1761_02765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634823.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter permease"
/protein_id="AQW33307.1"
gene complement(511424..513391)
/locus_tag="B1761_02770"
CDS complement(511424..513391)
/locus_tag="B1761_02770"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607872.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
/protein_id="AQW33308.1"
gene 513746..515003
/locus_tag="B1761_02775"
/pseudo
CDS 513746..515003
/locus_tag="B1761_02775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621432.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(515041..517011)
/locus_tag="B1761_02780"
CDS complement(515041..517011)
/locus_tag="B1761_02780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093456.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
/protein_id="AQW33309.1"
gene 517316..517606
/locus_tag="B1761_02785"
CDS 517316..517606
/locus_tag="B1761_02785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002987933.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33310.1"
gene 517624..518463
/locus_tag="B1761_02790"
CDS 517624..518463
/locus_tag="B1761_02790"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003108465.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33311.1"
gene complement(518504..518590)
/locus_tag="B1761_02795"
/pseudo
CDS complement(518504..518590)
/locus_tag="B1761_02795"
/inference="COORDINATES: protein motif:HMM:PF13333.4"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(518676..518846)
/locus_tag="B1761_02800"
CDS complement(518676..518846)
/locus_tag="B1761_02800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608546.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33312.1"
gene complement(518859..519164)
/locus_tag="B1761_02805"
CDS complement(518859..519164)
/locus_tag="B1761_02805"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608547.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter permease"
/protein_id="AQW33313.1"
gene complement(519184..519435)
/locus_tag="B1761_02810"
CDS complement(519184..519435)
/locus_tag="B1761_02810"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608548.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hydrolase"
/protein_id="AQW33314.1"
gene 519781..520986
/locus_tag="B1761_02815"
CDS 519781..520986
/locus_tag="B1761_02815"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621806.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MFS transporter"
/protein_id="AQW33315.1"
gene complement(521032..521796)
/locus_tag="B1761_02820"
/pseudo
CDS complement(521032..521796)
/locus_tag="B1761_02820"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003007166.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(521847..522113)
/locus_tag="B1761_02825"
CDS complement(521847..522113)
/locus_tag="B1761_02825"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681422.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33316.1"
gene complement(522136..522441)
/locus_tag="B1761_02830"
/pseudo
CDS complement(522136..522441)
/locus_tag="B1761_02830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002944924.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(522470..523453)
/locus_tag="B1761_02835"
CDS complement(522470..523453)
/locus_tag="B1761_02835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094325.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphate acetyltransferase"
/protein_id="AQW33317.1"
gene complement(523467..524363)
/locus_tag="B1761_02840"
CDS complement(523467..524363)
/locus_tag="B1761_02840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535168.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA pseudouridine synthase"
/protein_id="AQW33318.1"
gene complement(524360..525196)
/locus_tag="B1761_02845"
CDS complement(524360..525196)
/locus_tag="B1761_02845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951441.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NAD(+) kinase"
/protein_id="AQW33319.1"
gene complement(525168..525842)
/locus_tag="B1761_02850"
CDS complement(525168..525842)
/locus_tag="B1761_02850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681427.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTP pyrophosphokinase"
/protein_id="AQW33320.1"
gene 525938..526513
/locus_tag="B1761_02855"
CDS 525938..526513
/locus_tag="B1761_02855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094309.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="adenylate cyclase"
/protein_id="AQW33321.1"
gene 526875..527846
/locus_tag="B1761_02860"
CDS 526875..527846
/locus_tag="B1761_02860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000840703.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribose-phosphate diphosphokinase"
/protein_id="AQW33322.1"
gene 527850..528962
/locus_tag="B1761_02865"
CDS 527850..528962
/locus_tag="B1761_02865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681429.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cysteine desulfurase"
/protein_id="AQW33323.1"
gene 528964..529311
/locus_tag="B1761_02870"
CDS 528964..529311
/locus_tag="B1761_02870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948028.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cysteine desulfurase"
/protein_id="AQW33324.1"
gene 529455..530114
/locus_tag="B1761_02875"
CDS 529455..530114
/locus_tag="B1761_02875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608556.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="redox-sensing transcriptional repressor Rex"
/protein_id="AQW33325.1"
gene 530107..530802
/locus_tag="B1761_02880"
CDS 530107..530802
/locus_tag="B1761_02880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951449.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="gamma-glutamyl hydrolase"
/protein_id="AQW33326.1"
gene complement(530855..531541)
/locus_tag="B1761_02885"
CDS complement(530855..531541)
/locus_tag="B1761_02885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951450.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33327.1"
gene complement(531587..533230)
/locus_tag="B1761_02890"
CDS complement(531587..533230)
/locus_tag="B1761_02890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608558.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="rhamnosyl transferase"
/protein_id="AQW33328.1"
gene complement(533231..534433)
/locus_tag="B1761_02895"
CDS complement(533231..534433)
/locus_tag="B1761_02895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011837183.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW33329.1"
gene complement(534433..535239)
/locus_tag="B1761_02900"
CDS complement(534433..535239)
/locus_tag="B1761_02900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004190909.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LPS ABC transporter"
/protein_id="AQW33330.1"
gene complement(535240..536178)
/locus_tag="B1761_02905"
CDS complement(535240..536178)
/locus_tag="B1761_02905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608561.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alpha-L-Rha alpha-1,3-L-rhamnosyltransferase"
/protein_id="AQW33331.1"
gene complement(536175..537323)
/locus_tag="B1761_02910"
CDS complement(536175..537323)
/locus_tag="B1761_02910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018371894.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW33332.1"
gene complement(537521..539032)
/locus_tag="B1761_02915"
/pseudo
CDS complement(537521..539032)
/locus_tag="B1761_02915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990208.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(539054..540295)
/locus_tag="B1761_02920"
CDS complement(539054..540295)
/locus_tag="B1761_02920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884571.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase family 1"
/protein_id="AQW33333.1"
gene complement(540299..541606)
/locus_tag="B1761_02925"
CDS complement(540299..541606)
/locus_tag="B1761_02925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093489.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="beta-carotene 15,15'-monooxygenase"
/protein_id="AQW33334.1"
gene complement(541593..544607)
/locus_tag="B1761_02930"
CDS complement(541593..544607)
/locus_tag="B1761_02930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003027701.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW34525.1"
gene complement(544814..545590)
/locus_tag="B1761_02935"
CDS complement(544814..545590)
/locus_tag="B1761_02935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886818.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW33335.1"
gene complement(545580..545936)
/locus_tag="B1761_02940"
CDS complement(545580..545936)
/locus_tag="B1761_02940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002897243.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33336.1"
gene complement(545936..546652)
/locus_tag="B1761_02945"
CDS complement(545936..546652)
/locus_tag="B1761_02945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015604473.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase family 2"
/protein_id="AQW33337.1"
gene complement(546653..547621)
/locus_tag="B1761_02950"
CDS complement(546653..547621)
/locus_tag="B1761_02950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608570.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW33338.1"
gene complement(547632..548615)
/locus_tag="B1761_02955"
CDS complement(547632..548615)
/locus_tag="B1761_02955"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608571.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW33339.1"
gene complement(548612..549871)
/locus_tag="B1761_02960"
CDS complement(548612..549871)
/locus_tag="B1761_02960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681445.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sugar transporter"
/protein_id="AQW33340.1"
gene complement(549990..550841)
/locus_tag="B1761_02965"
CDS complement(549990..550841)
/locus_tag="B1761_02965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014713146.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NAD(P)-dependent oxidoreductase"
/protein_id="AQW33341.1"
gene complement(550914..552220)
/locus_tag="B1761_02970"
/pseudo
CDS complement(550914..552220)
/locus_tag="B1761_02970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608573.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(552225..553151)
/locus_tag="B1761_02975"
CDS complement(552225..553151)
/locus_tag="B1761_02975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002293526.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyltransferase"
/protein_id="AQW33342.1"
gene complement(553161..553496)
/locus_tag="B1761_02980"
CDS complement(553161..553496)
/locus_tag="B1761_02980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014294803.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aromatic ring hydroxylase"
/protein_id="AQW34526.1"
gene complement(553550..556474)
/locus_tag="B1761_02985"
/pseudo
CDS complement(553550..556474)
/locus_tag="B1761_02985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017645885.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 556572..556697
/locus_tag="B1761_02990"
CDS 556572..556697
/locus_tag="B1761_02990"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608575.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidine kinase"
/protein_id="AQW33343.1"
gene complement(556856..557032)
/locus_tag="B1761_02995"
CDS complement(556856..557032)
/locus_tag="B1761_02995"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681449.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S21"
/protein_id="AQW33344.1"
gene complement(557227..558021)
/locus_tag="B1761_03000"
CDS complement(557227..558021)
/locus_tag="B1761_03000"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621826.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter substrate-binding
protein"
/protein_id="AQW33345.1"
gene complement(558083..559192)
/locus_tag="B1761_03005"
CDS complement(558083..559192)
/locus_tag="B1761_03005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886805.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminotransferase"
/protein_id="AQW33346.1"
gene complement(559539..560336)
/locus_tag="B1761_03010"
CDS complement(559539..560336)
/locus_tag="B1761_03010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889444.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter substrate-binding
protein"
/protein_id="AQW33347.1"
gene complement(560333..561163)
/locus_tag="B1761_03015"
CDS complement(560333..561163)
/locus_tag="B1761_03015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951496.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter substrate-binding
protein"
/protein_id="AQW33348.1"
gene complement(561377..561841)
/locus_tag="B1761_03020"
CDS complement(561377..561841)
/locus_tag="B1761_03020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681454.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="7,8-dihydro-8-oxoguanine triphosphatase"
/protein_id="AQW33349.1"
gene complement(561886..563877)
/locus_tag="B1761_03025"
CDS complement(561886..563877)
/locus_tag="B1761_03025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002261961.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="excinuclease ABC subunit B"
/protein_id="AQW33350.1"
gene complement(564024..564491)
/locus_tag="B1761_03030"
CDS complement(564024..564491)
/locus_tag="B1761_03030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608580.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33351.1"
gene complement(564564..565500)
/locus_tag="B1761_03035"
/pseudo
CDS complement(564564..565500)
/locus_tag="B1761_03035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018165498.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="CAAX protease family protein"
gene 565699..567909
/locus_tag="B1761_03040"
CDS 565699..567909
/locus_tag="B1761_03040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004198070.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter permease"
/protein_id="AQW33352.1"
gene 567909..568649
/locus_tag="B1761_03045"
CDS 567909..568649
/locus_tag="B1761_03045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004226286.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
/protein_id="AQW33353.1"
gene complement(568722..568919)
/locus_tag="B1761_03050"
CDS complement(568722..568919)
/locus_tag="B1761_03050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953361.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTPase"
/protein_id="AQW33354.1"
gene complement(569086..570399)
/gene="obgE"
/locus_tag="B1761_03055"
CDS complement(569086..570399)
/gene="obgE"
/locus_tag="B1761_03055"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002984148.1"
/note="ObgE; essential GTPase; exhibits high exchange rate
for GTP/GDP; associates with 50S ribosomal subunit;
involved in regulation of chromosomal replication; Derived
by automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTPase ObgE"
/protein_id="AQW33355.1"
gene complement(570493..570621)
/locus_tag="B1761_03060"
CDS complement(570493..570621)
/locus_tag="B1761_03060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953363.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF4044 domain-containing protein"
/protein_id="AQW33356.1"
gene complement(570703..571668)
/locus_tag="B1761_03065"
/pseudo
CDS complement(570703..571668)
/locus_tag="B1761_03065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014712877.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="16S rRNA pseudouridine(516) synthase"
gene complement(571804..572247)
/locus_tag="B1761_03070"
CDS complement(571804..572247)
/locus_tag="B1761_03070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621838.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33357.1"
gene complement(572278..572661)
/locus_tag="B1761_03075"
CDS complement(572278..572661)
/locus_tag="B1761_03075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951502.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thioesterase"
/protein_id="AQW33358.1"
gene complement(572755..573059)
/locus_tag="B1761_03080"
/pseudo
CDS complement(572755..573059)
/locus_tag="B1761_03080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681463.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peroxiredoxin"
gene 573350..573592
/locus_tag="B1761_03085"
CDS 573350..573592
/locus_tag="B1761_03085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621840.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33359.1"
gene 573760..574650
/locus_tag="B1761_03090"
CDS 573760..574650
/locus_tag="B1761_03090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226363.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="EamA family transporter"
/protein_id="AQW33360.1"
gene complement(574688..574927)
/locus_tag="B1761_03095"
CDS complement(574688..574927)
/locus_tag="B1761_03095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681466.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33361.1"
repeat_region 575011..576303
/inference="COORDINATES: alignment:crt:1.2"
/inference="COORDINATES: alignment:pilercr:v1.02"
/rpt_family="CRISPR"
/rpt_type=direct
/rpt_unit_range=575011..575046
/rpt_unit_seq="gttttggaaccattcgaaacaacacagctctaaaac"
gene complement(576625..577284)
/locus_tag="B1761_03100"
CDS complement(576625..577284)
/locus_tag="B1761_03100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002352407.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type II-A CRISPR-associated protein Csn2"
/protein_id="AQW33362.1"
gene complement(577274..577618)
/locus_tag="B1761_03105"
CDS complement(577274..577618)
/locus_tag="B1761_03105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016502835.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CRISPR-associated endonuclease Cas2"
/protein_id="AQW33363.1"
gene complement(577615..578484)
/locus_tag="B1761_03110"
CDS complement(577615..578484)
/locus_tag="B1761_03110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002989953.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="subtype II CRISPR-associated endonuclease Cas1"
/protein_id="AQW33364.1"
gene complement(578484..582650)
/locus_tag="B1761_03115"
CDS complement(578484..582650)
/locus_tag="B1761_03115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727651.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type II CRISPR RNA-guided endonuclease Cas9"
/protein_id="AQW33365.1"
gene complement(582983..583630)
/locus_tag="B1761_03120"
CDS complement(582983..583630)
/locus_tag="B1761_03120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227449.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoserine phosphatase SerB"
/protein_id="AQW33366.1"
gene complement(583742..585466)
/locus_tag="B1761_03125"
CDS complement(583742..585466)
/locus_tag="B1761_03125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990185.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="septation ring formation regulator EzrA"
/protein_id="AQW33367.1"
gene complement(585563..587515)
/locus_tag="B1761_03130"
CDS complement(585563..587515)
/locus_tag="B1761_03130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002283665.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA gyrase subunit B"
/protein_id="AQW33368.1"
gene complement(587516..588076)
/locus_tag="B1761_03135"
CDS complement(587516..588076)
/locus_tag="B1761_03135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951524.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA gyrase subunit B"
/protein_id="AQW34527.1"
gene complement(588162..588857)
/locus_tag="B1761_03140"
CDS complement(588162..588857)
/locus_tag="B1761_03140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608597.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33369.1"
gene complement(588850..589224)
/locus_tag="B1761_03145"
CDS complement(588850..589224)
/locus_tag="B1761_03145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951531.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="murein hydrolase regulator LrgA"
/protein_id="AQW33370.1"
gene complement(589376..589446)
/locus_tag="B1761_03150"
tRNA complement(589376..589446)
/locus_tag="B1761_03150"
/product="tRNA-Thr"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(589412..589414),aa:Thr,seq:ggt)
gene complement(589504..589857)
/locus_tag="B1761_03155"
CDS complement(589504..589857)
/locus_tag="B1761_03155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096491.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="arsenate reductase family protein"
/protein_id="AQW33371.1"
gene complement(589892..590385)
/locus_tag="B1761_03160"
/pseudo
CDS complement(589892..590385)
/locus_tag="B1761_03160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634869.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="cysteine methyltransferase"
gene complement(590443..591621)
/locus_tag="B1761_03165"
CDS complement(590443..591621)
/locus_tag="B1761_03165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951533.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoglycerate dehydrogenase"
/protein_id="AQW33372.1"
gene complement(591640..592197)
/locus_tag="B1761_03170"
CDS complement(591640..592197)
/locus_tag="B1761_03170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096484.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GNAT family N-acetyltransferase"
/protein_id="AQW33373.1"
gene complement(592209..593303)
/locus_tag="B1761_03175"
CDS complement(592209..593303)
/locus_tag="B1761_03175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634872.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoserine aminotransferase"
/protein_id="AQW33374.1"
gene complement(593457..594077)
/locus_tag="B1761_03180"
CDS complement(593457..594077)
/locus_tag="B1761_03180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608601.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33375.1"
gene complement(594067..594360)
/locus_tag="B1761_03185"
/pseudo
CDS complement(594067..594360)
/locus_tag="B1761_03185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951539.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
gene 594406..594801
/locus_tag="B1761_03190"
CDS 594406..594801
/locus_tag="B1761_03190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887686.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lactoylglutathione lyase"
/protein_id="AQW33376.1"
gene complement(594845..595748)
/locus_tag="B1761_03195"
/pseudo
CDS complement(594845..595748)
/locus_tag="B1761_03195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884203.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="SPFH domain-containing protein"
gene complement(595938..597005)
/locus_tag="B1761_03200"
CDS complement(595938..597005)
/locus_tag="B1761_03200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891519.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="spermidine/putrescine ABC transporter
substrate-binding protein"
/protein_id="AQW33377.1"
gene complement(596998..597777)
/locus_tag="B1761_03205"
CDS complement(596998..597777)
/locus_tag="B1761_03205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951546.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="spermidine/putrescine ABC transporter permease
PotC"
/protein_id="AQW33378.1"
gene complement(597774..598568)
/locus_tag="B1761_03210"
CDS complement(597774..598568)
/locus_tag="B1761_03210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008089503.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="spermidine/putrescine ABC transporter permease"
/protein_id="AQW33379.1"
gene complement(598552..599706)
/locus_tag="B1761_03215"
CDS complement(598552..599706)
/locus_tag="B1761_03215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226381.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="spermidine/putrescine import ATP-binding protein
PotA"
/protein_id="AQW33380.1"
gene complement(599751..600653)
/locus_tag="B1761_03220"
CDS complement(599751..600653)
/locus_tag="B1761_03220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535264.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylenolpyruvoylglucosamine reductase"
/protein_id="AQW34528.1"
gene complement(600842..601333)
/locus_tag="B1761_03225"
CDS complement(600842..601333)
/locus_tag="B1761_03225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953383.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2-amino-4-hydroxy-6-
hydroxymethyldihydropteridine diphosphokinase"
/protein_id="AQW33381.1"
gene complement(601330..601689)
/locus_tag="B1761_03230"
CDS complement(601330..601689)
/locus_tag="B1761_03230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094589.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydroneopterin aldolase"
/protein_id="AQW33382.1"
gene 601910..603361
/locus_tag="B1761_03235"
CDS 601910..603361
/locus_tag="B1761_03235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681482.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alpha-amylase"
/protein_id="AQW33383.1"
gene complement(603393..604193)
/locus_tag="B1761_03240"
CDS complement(603393..604193)
/locus_tag="B1761_03240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991014.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydropteroate synthase"
/protein_id="AQW33384.1"
gene complement(604232..604795)
/locus_tag="B1761_03245"
CDS complement(604232..604795)
/locus_tag="B1761_03245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002945852.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTP cyclohydrolase I FolE"
/protein_id="AQW33385.1"
gene complement(604941..606785)
/locus_tag="B1761_03250"
CDS complement(604941..606785)
/locus_tag="B1761_03250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226386.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid permease"
/protein_id="AQW33386.1"
gene complement(606849..608111)
/locus_tag="B1761_03255"
CDS complement(606849..608111)
/locus_tag="B1761_03255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226387.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydrofolate synthase"
/protein_id="AQW33387.1"
gene complement(608266..608514)
/locus_tag="B1761_03260"
CDS complement(608266..608514)
/locus_tag="B1761_03260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093900.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA-binding protein"
/protein_id="AQW33388.1"
gene complement(608526..608798)
/locus_tag="B1761_03265"
CDS complement(608526..608798)
/locus_tag="B1761_03265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884675.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S16"
/protein_id="AQW33389.1"
gene 609229..610107
/locus_tag="B1761_03270"
CDS 609229..610107
/locus_tag="B1761_03270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227463.1"
/note="with TehA confers resistance to tellurite; Derived
by automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tellurite resistance methyltransferase TehB"
/protein_id="AQW33390.1"
gene 611263..612090
/locus_tag="B1761_03275"
CDS 611263..612090
/locus_tag="B1761_03275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006596696.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="exodeoxyribonuclease III"
/protein_id="AQW33391.1"
gene 612164..612643
/locus_tag="B1761_03280"
CDS 612164..612643
/locus_tag="B1761_03280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884216.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33392.1"
gene complement(612763..613457)
/locus_tag="B1761_03285"
/pseudo
CDS complement(612763..613457)
/locus_tag="B1761_03285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017771557.1"
/note="frameshifted; internal stop; incomplete; partial on
complete genome; missing start; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(613592..614605)
/locus_tag="B1761_03290"
CDS complement(613592..614605)
/locus_tag="B1761_03290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093200.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="diacylglycerol kinase"
/protein_id="AQW33393.1"
gene complement(614615..616573)
/gene="ligA"
/locus_tag="B1761_03295"
CDS complement(614615..616573)
/gene="ligA"
/locus_tag="B1761_03295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226393.1"
/note="this protein catalyzes the formation of
phosphodiester linkages between 5'-phosphoryl and
3'-hydroxyl groups in double-stranded DNA using NAD as a
coenzyme and as the energy source for the reaction;
essential for DNA replication and repair of damaged DNA;
similar to ligase LigB; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA ligase (NAD(+)) LigA"
/protein_id="AQW33394.1"
gene complement(616624..617133)
/locus_tag="B1761_03300"
CDS complement(616624..617133)
/locus_tag="B1761_03300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096445.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="queuosine transporter QueT"
/protein_id="AQW33395.1"
gene complement(617224..618189)
/locus_tag="B1761_03305"
CDS complement(617224..618189)
/locus_tag="B1761_03305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946154.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease BN"
/protein_id="AQW33396.1"
gene complement(618191..619051)
/locus_tag="B1761_03310"
CDS complement(618191..619051)
/locus_tag="B1761_03310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014622584.1"
/note="catalyzes the removal of N-terminal amino acids
from peptides and arylamides; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="methionine aminopeptidase"
/protein_id="AQW33397.1"
gene complement(619095..620375)
/locus_tag="B1761_03315"
CDS complement(619095..620375)
/locus_tag="B1761_03315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608610.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33398.1"
gene complement(620368..620913)
/locus_tag="B1761_03320"
CDS complement(620368..620913)
/locus_tag="B1761_03320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951573.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetyltransferase"
/protein_id="AQW33399.1"
gene complement(620979..622241)
/locus_tag="B1761_03325"
CDS complement(620979..622241)
/locus_tag="B1761_03325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001226236.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylglucosamine
1-carboxyvinyltransferase"
/protein_id="AQW33400.1"
gene complement(622327..624567)
/locus_tag="B1761_03330"
CDS complement(622327..624567)
/locus_tag="B1761_03330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226399.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA internalization-related competence protein
ComEC/Rec2"
/protein_id="AQW33401.1"
gene complement(624557..625252)
/locus_tag="B1761_03335"
CDS complement(624557..625252)
/locus_tag="B1761_03335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183181.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein"
/protein_id="AQW33402.1"
gene complement(625360..626114)
/locus_tag="B1761_03340"
/pseudo
CDS complement(625360..626114)
/locus_tag="B1761_03340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991035.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="1-acyl-sn-glycerol-3-phosphate acyltransferase"
gene 626263..627105
/locus_tag="B1761_03345"
/pseudo
CDS 626263..627105
/locus_tag="B1761_03345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621873.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="polysaccharide deacetylase"
gene 627155..627919
/locus_tag="B1761_03350"
CDS 627155..627919
/locus_tag="B1761_03350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884567.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SAM-dependent methyltransferase"
/protein_id="AQW33403.1"
gene 627923..628192
/locus_tag="B1761_03355"
CDS 627923..628192
/locus_tag="B1761_03355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621874.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33404.1"
gene complement(628747..630333)
/locus_tag="B1761_03360"
CDS complement(628747..630333)
/locus_tag="B1761_03360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006531501.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-dependent RNA helicase"
/protein_id="AQW33405.1"
gene complement(630524..631432)
/locus_tag="B1761_03365"
CDS complement(630524..631432)
/locus_tag="B1761_03365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226406.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1 /transl_table=11
/product="magnesium transporter"
/protein_id="AQW33406.1"
gene complement(631446..631826)
/locus_tag="B1761_03370"
CDS complement(631446..631826)
/locus_tag="B1761_03370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018381253.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="helicase"
/protein_id="AQW33407.1"
regulatory 631929..632049
/regulatory_class="riboswitch"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00059"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="TPP riboswitch; Derived by automated computational
analysis using gene prediction method: cmsearch."
/bound_moiety="thiamine pyrophosphate"
/db_xref="RFAM:RF00059"
gene 632127..632702
/locus_tag="B1761_03375"
CDS 632127..632702
/locus_tag="B1761_03375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226407.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="energy-coupled thiamine transporter ThiT"
/protein_id="AQW33408.1"
gene 633153..634016
/locus_tag="B1761_03380"
CDS 633153..634016
/locus_tag="B1761_03380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681501.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MutR family transcriptional regulator"
/protein_id="AQW33409.1"
gene 634133..635311
/locus_tag="B1761_03385"
CDS 634133..635311
/locus_tag="B1761_03385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951594.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MFS transporter"
/protein_id="AQW33410.1"
gene complement(635681..637225)
/locus_tag="B1761_03390"
CDS complement(635681..637225)
/locus_tag="B1761_03390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681503.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide chain release factor 3"
/protein_id="AQW33411.1"
gene complement(637575..638240)
/locus_tag="B1761_03395"
CDS complement(637575..638240)
/locus_tag="B1761_03395"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183200.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33412.1"
gene complement(638329..639702)
/locus_tag="B1761_03400"
CDS complement(638329..639702)
/locus_tag="B1761_03400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608619.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-
alanine ligase"
/protein_id="AQW33413.1"
gene 639949..640542
/locus_tag="B1761_03405"
/pseudo
CDS 639949..640542
/locus_tag="B1761_03405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727660.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 640511..640894
/locus_tag="B1761_03410"
CDS 640511..640894
/locus_tag="B1761_03410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681508.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33414.1"
gene complement(641284..642138)
/locus_tag="B1761_03415"
CDS complement(641284..642138)
/locus_tag="B1761_03415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197296.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter substrate-binding
protein"
/protein_id="AQW33415.1"
gene complement(642181..642939)
/locus_tag="B1761_03420"
CDS complement(642181..642939)
/locus_tag="B1761_03420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012000401.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine ABC transporter ATP-binding protein"
/protein_id="AQW33416.1"
gene complement(642941..643618)
/locus_tag="B1761_03425"
CDS complement(642941..643618)
/locus_tag="B1761_03425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001154125.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter permease"
/protein_id="AQW33417.1"
gene complement(643578..644258)
/locus_tag="B1761_03430"
CDS complement(643578..644258)
/locus_tag="B1761_03430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891586.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="polar amino acid ABC transporter permease"
/protein_id="AQW33418.1"
gene complement(644586..645632)
/locus_tag="B1761_03435"
CDS complement(644586..645632)
/locus_tag="B1761_03435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888537.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanine--D-alanine ligase A"
/protein_id="AQW33419.1"
gene complement(645793..645996)
/locus_tag="B1761_03440"
CDS complement(645793..645996)
/locus_tag="B1761_03440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018163957.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="carbonate dehydratase"
/protein_id="AQW33420.1"
gene complement(646070..648301)
/locus_tag="B1761_03445"
CDS complement(646070..648301)
/locus_tag="B1761_03445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002264872.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="copper-translocating P-type ATPase"
/protein_id="AQW33421.1"
gene complement(648305..648736)
/locus_tag="B1761_03450"
CDS complement(648305..648736)
/locus_tag="B1761_03450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951615.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="uracil phosphoribosyltransferase"
/protein_id="AQW33422.1"
gene complement(648881..649663)
/locus_tag="B1761_03455"
CDS complement(648881..649663)
/locus_tag="B1761_03455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951616.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tryptophan synthase subunit alpha"
/protein_id="AQW33423.1"
gene complement(649667..650875)
/locus_tag="B1761_03460"
CDS complement(649667..650875)
/locus_tag="B1761_03460"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002959933.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tryptophan synthase subunit beta"
/protein_id="AQW33424.1"
gene complement(650872..651453)
/locus_tag="B1761_03465"
CDS complement(650872..651453)
/locus_tag="B1761_03465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991048.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-(5'-phosphoribosyl)anthranilate isomerase"
/protein_id="AQW33425.1"
gene complement(651440..652207)
/locus_tag="B1761_03470"
CDS complement(651440..652207)
/locus_tag="B1761_03470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227478.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="indole-3-glycerol phosphate synthase"
/protein_id="AQW33426.1"
gene complement(652204..653208)
/locus_tag="B1761_03475"
CDS complement(652204..653208)
/locus_tag="B1761_03475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006595989.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="anthranilate phosphoribosyltransferase"
/protein_id="AQW33427.1"
gene complement(653299..653865)
/locus_tag="B1761_03480"
CDS complement(653299..653865)
/locus_tag="B1761_03480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681520.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine amidotransferase"
/protein_id="AQW33428.1"
gene complement(653862..655217)
/locus_tag="B1761_03485"
CDS complement(653862..655217)
/locus_tag="B1761_03485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884468.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="anthranilate synthase component I"
/protein_id="AQW33429.1"
gene complement(655294..655575)
/locus_tag="B1761_03490"
CDS complement(655294..655575)
/locus_tag="B1761_03490"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621888.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chorismate mutase"
/protein_id="AQW33430.1"
gene complement(656170..656520)
/locus_tag="B1761_03495"
CDS complement(656170..656520)
/locus_tag="B1761_03495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004198113.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydroorotate dehydrogenase"
/protein_id="AQW33431.1"
gene complement(656602..658962)
/locus_tag="B1761_03500"
CDS complement(656602..658962)
/locus_tag="B1761_03500"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608629.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATPase"
/protein_id="AQW33432.1"
gene complement(659223..659618)
/locus_tag="B1761_03505"
CDS complement(659223..659618)
/locus_tag="B1761_03505"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681525.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33433.1"
gene 659927..660226
/locus_tag="B1761_03510"
CDS 659927..660226
/locus_tag="B1761_03510"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008808250.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="YbaB/EbfC family nucleoid-associated protein"
/protein_id="AQW33434.1"
gene complement(660492..660674)
/locus_tag="B1761_03515"
CDS complement(660492..660674)
/locus_tag="B1761_03515"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608632.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33435.1"
gene complement(660780..661508)
/locus_tag="B1761_03520"
CDS complement(660780..661508)
/locus_tag="B1761_03520"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884265.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MerR family transcriptional regulator"
/protein_id="AQW33436.1"
gene complement(661683..662273)
/locus_tag="B1761_03525"
CDS complement(661683..662273)
/locus_tag="B1761_03525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183255.1"
/note="3'-5' exonuclease of DNA polymerase III; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3'-5' exonuclease"
/protein_id="AQW33437.1"
gene complement(662323..662859)
/locus_tag="B1761_03530"
CDS complement(662323..662859)
/locus_tag="B1761_03530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015911912.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF536 domain-containing protein"
/protein_id="AQW33438.1"
gene 663364..663723
/locus_tag="B1761_03535"
CDS 663364..663723
/locus_tag="B1761_03535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951648.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cytosolic protein"
/protein_id="AQW33439.1"
gene complement(663871..665574)
/locus_tag="B1761_03540"
CDS complement(663871..665574)
/locus_tag="B1761_03540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535381.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydroxy-acid dehydratase"
/protein_id="AQW34529.1"
gene 665702..666883
/locus_tag="B1761_03545"
CDS 665702..666883
/locus_tag="B1761_03545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951656.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33440.1"
gene complement(666973..667059)
/locus_tag="B1761_03550"
tRNA complement(666973..667059)
/locus_tag="B1761_03550"
/product="tRNA-Ser"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(667023..667025),aa:Ser,seq:gga)
gene complement(667119..667760)
/locus_tag="B1761_03555"
CDS complement(667119..667760)
/locus_tag="B1761_03555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535383.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA (guanosine(46)-N7)-methyltransferase TrmB"
/protein_id="AQW33441.1"
gene complement(667770..668561)
/locus_tag="B1761_03560"
CDS complement(667770..668561)
/locus_tag="B1761_03560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951667.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminoglycoside phosphotransferase"
/protein_id="AQW33442.1"
gene complement(668619..669656)
/locus_tag="B1761_03565"
CDS complement(668619..669656)
/locus_tag="B1761_03565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535385.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter permease"
/protein_id="AQW33443.1"
gene complement(669653..670384)
/locus_tag="B1761_03570"
CDS complement(669653..670384)
/locus_tag="B1761_03570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991070.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW33444.1"
gene 670449..670868
/locus_tag="B1761_03575"
CDS 670449..670868
/locus_tag="B1761_03575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183267.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HIT family protein"
/protein_id="AQW33445.1"
gene 670865..671173
/locus_tag="B1761_03580"
CDS 670865..671173
/locus_tag="B1761_03580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951678.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33446.1"
gene complement(671215..671946)
/locus_tag="B1761_03585"
CDS complement(671215..671946)
/locus_tag="B1761_03585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608636.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33447.1"
gene complement(671965..672600)
/locus_tag="B1761_03590"
CDS complement(671965..672600)
/locus_tag="B1761_03590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727665.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosylglycinamide synthetase"
/protein_id="AQW33448.1"
gene complement(673164..675263)
/locus_tag="B1761_03595"
CDS complement(673164..675263)
/locus_tag="B1761_03595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227488.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-dependent Clp protease ATP-binding subunit"
/protein_id="AQW33449.1"
gene complement(675977..677068)
/locus_tag="B1761_03600"
CDS complement(675977..677068)
/locus_tag="B1761_03600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226442.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33450.1"
gene complement(677075..677884)
/locus_tag="B1761_03605"
CDS complement(677075..677884)
/locus_tag="B1761_03605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002877461.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SAM-dependent methyltransferase"
/protein_id="AQW33451.1"
gene complement(678140..678493)
/locus_tag="B1761_03610"
CDS complement(678140..678493)
/locus_tag="B1761_03610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887380.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosome silencing factor RsfS"
/protein_id="AQW33452.1"
gene complement(678517..679107)
/locus_tag="B1761_03615"
CDS complement(678517..679107)
/locus_tag="B1761_03615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951696.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HD domain-containing protein"
/protein_id="AQW33453.1"
gene complement(679104..679736)
/gene="nadD"
/locus_tag="B1761_03620"
CDS complement(679104..679736)
/gene="nadD"
/locus_tag="B1761_03620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002960817.1"
/note="transfers an adenyl group from ATP to NaMN to form
nicotinic acid adenine dinucleotide (NaAD) which is then
converted to the ubiquitous compound NAD by NAD
synthetase; essential enzyme in bacteria; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nicotinate-nicotinamide nucleotide
adenylyltransferase"
/protein_id="AQW33454.1"
gene complement(679840..680157)
/locus_tag="B1761_03625"
CDS complement(679840..680157)
/locus_tag="B1761_03625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535405.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA-binding protein"
/protein_id="AQW33455.1"
gene complement(680396..681514)
/locus_tag="B1761_03630"
CDS complement(680396..681514)
/locus_tag="B1761_03630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018363769.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosome biogenesis GTPase YqeH"
/protein_id="AQW33456.1"
gene complement(681514..682041)
/locus_tag="B1761_03635"
CDS complement(681514..682041)
/locus_tag="B1761_03635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096279.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HAD family hydrolase"
/protein_id="AQW33457.1"
gene complement(682178..683092)
/locus_tag="B1761_03640"
CDS complement(682178..683092)
/locus_tag="B1761_03640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226447.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="EamA family transporter"
/protein_id="AQW33458.1"
gene complement(683169..683507)
/locus_tag="B1761_03645"
CDS complement(683169..683507)
/locus_tag="B1761_03645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608640.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33459.1"
gene complement(683650..685092)
/locus_tag="B1761_03650"
CDS complement(683650..685092)
/locus_tag="B1761_03650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001008654.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase
subunit B"
/protein_id="AQW33460.1"
gene complement(685092..686558)
/gene="gatA"
/locus_tag="B1761_03655"
CDS complement(685092..686558)
/gene="gatA"
/locus_tag="B1761_03655"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013904071.1"
/note="allows the formation of correctly charged
Asn-tRNA(Asn) or Gln-tRNA(Gln) through the transamidation
of misacylated Asp-tRNA(Asn) or Glu-tRNA(Gln) in organisms
which lack either or both of asparaginyl-tRNA or
glutaminyl-tRNA synthetases; reaction takes place in the
presence of glutamine and ATP through an activated
phospho-Asp-tRNA(Asn) or phospho-Glu-tRNA; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartyl/glutamyl-tRNA amidotransferase subunit
A"
/protein_id="AQW33461.1"
gene complement(686558..686860)
/locus_tag="B1761_03660"
CDS complement(686558..686860)
/locus_tag="B1761_03660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006147946.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase
subunit C"
/protein_id="AQW33462.1"
gene complement(687000..687254)
/locus_tag="B1761_03665"
CDS complement(687000..687254)
/locus_tag="B1761_03665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951710.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyltransferase"
/protein_id="AQW33463.1"
gene complement(687267..687476)
/locus_tag="B1761_03670"
CDS complement(687267..687476)
/locus_tag="B1761_03670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951711.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyltransferase"
/protein_id="AQW33464.1"
gene complement(687792..689019)
/locus_tag="B1761_03675"
/pseudo
CDS complement(687792..689019)
/locus_tag="B1761_03675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946586.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="6-phospho-beta-glucosidase"
gene complement(689389..689898)
/locus_tag="B1761_03680"
CDS complement(689389..689898)
/locus_tag="B1761_03680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012677568.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide-methionine (S)-S-oxide reductase"
/protein_id="AQW33465.1"
gene complement(689910..690758)
/locus_tag="B1761_03685"
CDS complement(689910..690758)
/locus_tag="B1761_03685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018372132.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="O-sialoglycoprotein endopeptidase"
/protein_id="AQW33466.1"
gene complement(690882..691433)
/locus_tag="B1761_03690"
CDS complement(690882..691433)
/locus_tag="B1761_03690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946999.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="isochorismatase"
/protein_id="AQW33467.1"
gene complement(691496..692281)
/locus_tag="B1761_03695"
CDS complement(691496..692281)
/locus_tag="B1761_03695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018165201.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTP-sensing pleiotropic transcriptional
regulator CodY"
/protein_id="AQW33468.1"
gene complement(692541..693755)
/locus_tag="B1761_03700"
CDS complement(692541..693755)
/locus_tag="B1761_03700"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014295205.1"
/note="broad specificity; family IV; in Corynebacterium
glutamicum this protein can use glutamate,
2-aminobutyrate, and aspartate as amino donors and
pyruvate as the acceptor; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="aminotransferase"
/protein_id="AQW33469.1"
gene 694110..694562
/locus_tag="B1761_03705"
CDS 694110..694562
/locus_tag="B1761_03705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946987.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="universal stress protein UspA"
/protein_id="AQW33470.1"
gene 694775..695313
/locus_tag="B1761_03710"
/pseudo
CDS 694775..695313
/locus_tag="B1761_03710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003026277.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS30 family transposase"
gene complement(695619..695993)
/locus_tag="B1761_03715"
CDS complement(695619..695993)
/locus_tag="B1761_03715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951725.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33471.1"
gene complement(696205..697005)
/locus_tag="B1761_03720"
CDS complement(696205..697005)
/locus_tag="B1761_03720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991096.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pyruvate formate lyase-activating protein"
/protein_id="AQW33472.1"
gene complement(697193..697653)
/locus_tag="B1761_03725"
/pseudo
CDS complement(697193..697653)
/locus_tag="B1761_03725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991097.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(698001..699332)
/locus_tag="B1761_03730"
CDS complement(698001..699332)
/locus_tag="B1761_03730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094275.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hemolysin"
/protein_id="AQW33473.1"
gene 699444..700226
/locus_tag="B1761_03735"
CDS 699444..700226
/locus_tag="B1761_03735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096229.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="molybdenum ABC transporter ATP-binding protein"
/protein_id="AQW33474.1"
gene complement(700848..702914)
/locus_tag="B1761_03740"
CDS complement(700848..702914)
/locus_tag="B1761_03740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227498.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sodium:proton antiporter"
/protein_id="AQW33475.1"
gene complement(702923..703165)
/locus_tag="B1761_03745"
CDS complement(702923..703165)
/locus_tag="B1761_03745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951731.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33476.1"
gene complement(703162..703710)
/locus_tag="B1761_03750"
CDS complement(703162..703710)
/locus_tag="B1761_03750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951733.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SAM-dependent methyltransferase"
/protein_id="AQW33477.1"
gene complement(703707..704651)
/locus_tag="B1761_03755"
CDS complement(703707..704651)
/locus_tag="B1761_03755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951735.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="TIGR01212 family radical SAM protein"
/protein_id="AQW33478.1"
gene complement(704736..705773)
/locus_tag="B1761_03760"
CDS complement(704736..705773)
/locus_tag="B1761_03760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094794.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase S16"
/protein_id="AQW34530.1"
gene complement(705790..706287)
/locus_tag="B1761_03765"
CDS complement(705790..706287)
/locus_tag="B1761_03765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621910.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pantetheine-phosphate adenylyltransferase"
/protein_id="AQW33479.1"
gene complement(706321..706869)
/locus_tag="B1761_03770"
CDS complement(706321..706869)
/locus_tag="B1761_03770"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226466.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="16S rRNA (guanine(966)-N(2))-methyltransferase
RsmD"
/protein_id="AQW33480.1"
gene complement(707011..707931)
/locus_tag="B1761_03775"
CDS complement(707011..707931)
/locus_tag="B1761_03775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884706.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thioredoxin-disulfide reductase"
/protein_id="AQW33481.1"
gene complement(707997..708221)
/locus_tag="B1761_03780"
CDS complement(707997..708221)
/locus_tag="B1761_03780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093939.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thioredoxin"
/protein_id="AQW33482.1"
gene complement(708436..709179)
/locus_tag="B1761_03785"
CDS complement(708436..709179)
/locus_tag="B1761_03785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621912.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter ATP-binding protein"
/protein_id="AQW33483.1"
gene complement(709179..710102)
/locus_tag="B1761_03790"
CDS complement(709179..710102)
/locus_tag="B1761_03790"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535447.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter permease"
/protein_id="AQW33484.1"
gene complement(710313..711143)
/locus_tag="B1761_03795"
CDS complement(710313..711143)
/locus_tag="B1761_03795"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608653.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter substrate-binding
protein"
/protein_id="AQW33485.1"
gene complement(711603..711836)
/locus_tag="B1761_03800"
CDS complement(711603..711836)
/locus_tag="B1761_03800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951752.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33486.1"
gene complement(712134..713237)
/locus_tag="B1761_03805"
CDS complement(712134..713237)
/locus_tag="B1761_03805"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096195.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase IV"
/protein_id="AQW33487.1"
gene 713516..715825
/locus_tag="B1761_03810"
CDS 713516..715825
/locus_tag="B1761_03810"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951754.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="formate acetyltransferase"
/protein_id="AQW33488.1"
gene 716092..716874
/locus_tag="B1761_03815"
CDS 716092..716874
/locus_tag="B1761_03815"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953433.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="carbonate dehydratase"
/protein_id="AQW33489.1"
gene 716925..717377
/locus_tag="B1761_03820"
CDS 716925..717377
/locus_tag="B1761_03820"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891719.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GNAT family N-acetyltransferase"
/protein_id="AQW34531.1"
gene complement(717396..717600)
/locus_tag="B1761_03825"
/pseudo
CDS complement(717396..717600)
/locus_tag="B1761_03825"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094079.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
gene complement(717728..718033)
/locus_tag="B1761_03830"
CDS complement(717728..718033)
/locus_tag="B1761_03830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621914.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="restriction endonuclease subunit S"
/protein_id="AQW33490.1"
gene complement(718052..718566)
/locus_tag="B1761_03835"
/pseudo
CDS complement(718052..718566)
/locus_tag="B1761_03835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014333938.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(719011..719766)
/locus_tag="B1761_03840"
CDS complement(719011..719766)
/locus_tag="B1761_03840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016511890.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="iron export ABC transporter permease subunit
FetB"
/protein_id="AQW33491.1"
gene complement(719763..720413)
/locus_tag="B1761_03845"
CDS complement(719763..720413)
/locus_tag="B1761_03845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_010010572.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="spermidine/putrescine ABC transporter
ATP-binding protein"
/protein_id="AQW33492.1"
gene complement(720615..721571)
/locus_tag="B1761_03850"
CDS complement(720615..721571)
/locus_tag="B1761_03850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951776.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine hydrolase"
/protein_id="AQW33493.1"
gene complement(721571..722326)
/locus_tag="B1761_03855"
CDS complement(721571..722326)
/locus_tag="B1761_03855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094434.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase"
/protein_id="AQW33494.1"
gene 722608..722970
/locus_tag="B1761_03860"
CDS 722608..722970
/locus_tag="B1761_03860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608659.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CPBP family intramembrane metalloprotease"
/protein_id="AQW33495.1"
gene complement(723057..723920)
/locus_tag="B1761_03865"
CDS complement(723057..723920)
/locus_tag="B1761_03865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951781.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aquaporin"
/protein_id="AQW33496.1"
gene 724041..726308
/locus_tag="B1761_03870"
CDS 724041..726308
/locus_tag="B1761_03870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951782.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Xaa-Pro dipeptidyl-peptidase"
/protein_id="AQW33497.1"
gene complement(726388..726768)
/locus_tag="B1761_03875"
CDS complement(726388..726768)
/locus_tag="B1761_03875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951783.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin secretion protein"
/protein_id="AQW33498.1"
gene complement(727478..727774)
/locus_tag="B1761_03880"
CDS complement(727478..727774)
/locus_tag="B1761_03880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197070.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase"
/protein_id="AQW33499.1"
gene complement(727939..728145)
/locus_tag="B1761_03885"
CDS complement(727939..728145)
/locus_tag="B1761_03885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681562.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33500.1"
gene complement(728176..728865)
/locus_tag="B1761_03890"
CDS complement(728176..728865)
/locus_tag="B1761_03890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681563.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thiol reductase thioredoxin"
/protein_id="AQW33501.1"
gene 729059..729745
/locus_tag="B1761_03895"
CDS 729059..729745
/locus_tag="B1761_03895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681053.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33502.1"
gene 729760..730629
/locus_tag="B1761_03900"
CDS 729760..730629
/locus_tag="B1761_03900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681054.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33503.1"
gene complement(730775..731029)
/locus_tag="B1761_03905"
CDS complement(730775..731029)
/locus_tag="B1761_03905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608660.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin"
/protein_id="AQW33504.1"
gene complement(731280..731681)
/locus_tag="B1761_03910"
CDS complement(731280..731681)
/locus_tag="B1761_03910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634989.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33505.1"
gene complement(732275..732490)
/locus_tag="B1761_03915"
CDS complement(732275..732490)
/locus_tag="B1761_03915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096154.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33506.1"
gene complement(732686..732916)
/locus_tag="B1761_03920"
CDS complement(732686..732916)
/locus_tag="B1761_03920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226494.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin"
/protein_id="AQW33507.1"
gene complement(733272..733472)
/locus_tag="B1761_03925"
CDS complement(733272..733472)
/locus_tag="B1761_03925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681569.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin BlpI"
/protein_id="AQW33508.1"
gene complement(733491..733667)
/locus_tag="B1761_03930"
CDS complement(733491..733667)
/locus_tag="B1761_03930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681570.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin"
/protein_id="AQW33509.1"
gene 733923..734654
/locus_tag="B1761_03935"
CDS 733923..734654
/locus_tag="B1761_03935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226495.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
/protein_id="AQW33510.1"
gene 734654..735994
/locus_tag="B1761_03940"
CDS 734654..735994
/locus_tag="B1761_03940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948870.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidine kinase"
/protein_id="AQW33511.1"
gene complement(736012..736173)
/locus_tag="B1761_03945"
CDS complement(736012..736173)
/locus_tag="B1761_03945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681573.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin leader domain-containing protein"
/protein_id="AQW33512.1"
gene complement(736188..737555)
/locus_tag="B1761_03950"
CDS complement(736188..737555)
/locus_tag="B1761_03950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951803.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin ABC transporter ATP-binding protein"
/protein_id="AQW33513.1"
gene complement(737571..739724)
/locus_tag="B1761_03955"
CDS complement(737571..739724)
/locus_tag="B1761_03955"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953445.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin cleavage/export ABC transporter"
/protein_id="AQW33514.1"
gene 740159..740410
/locus_tag="B1761_03960"
CDS 740159..740410
/locus_tag="B1761_03960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226500.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33515.1"
gene complement(740738..742483)
/locus_tag="B1761_03965"
CDS complement(740738..742483)
/locus_tag="B1761_03965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621922.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW33516.1"
gene complement(742476..744233)
/locus_tag="B1761_03970"
CDS complement(742476..744233)
/locus_tag="B1761_03970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951810.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter permease/ATP-binding
protein"
/protein_id="AQW33517.1"
gene complement(744421..744627)
/locus_tag="B1761_03975"
CDS complement(744421..744627)
/locus_tag="B1761_03975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948879.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33518.1"
gene complement(744832..745359)
/locus_tag="B1761_03980"
CDS complement(744832..745359)
/locus_tag="B1761_03980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948881.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33519.1"
gene complement(745361..746530)
/locus_tag="B1761_03985"
CDS complement(745361..746530)
/locus_tag="B1761_03985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535509.1"
/note="23S rRNA m2A2503 methyltransferase; methylates the
C2 position of the A2530 nucleotide in 23S rRNA; may be
involved in antibiotic resistance; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="23S rRNA (adenine(2503)-C(2))-methyltransferase
RlmN"
/protein_id="AQW33520.1"
gene complement(746534..747256)
/locus_tag="B1761_03990"
CDS complement(746534..747256)
/locus_tag="B1761_03990"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621927.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33521.1"
gene complement(747311..748666)
/locus_tag="B1761_03995"
CDS complement(747311..748666)
/locus_tag="B1761_03995"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948886.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoesterase"
/protein_id="AQW34532.1"
gene complement(749514..750857)
/locus_tag="B1761_04000"
CDS complement(749514..750857)
/locus_tag="B1761_04000"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535518.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DEAD/DEAH box helicase"
/protein_id="AQW33522.1"
gene complement(750932..751954)
/locus_tag="B1761_04005"
CDS complement(750932..751954)
/locus_tag="B1761_04005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183389.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phospho-N-acetylmuramoyl-pentapeptide-
transferase"
/protein_id="AQW33523.1"
gene complement(751956..754223)
/locus_tag="B1761_04010"
CDS complement(751956..754223)
/locus_tag="B1761_04010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093532.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="penicillin-binding protein"
/protein_id="AQW33524.1"
gene complement(754227..754547)
/locus_tag="B1761_04015"
CDS complement(754227..754547)
/locus_tag="B1761_04015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226509.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein FtsL"
/protein_id="AQW33525.1"
gene complement(754550..755500)
/locus_tag="B1761_04020"
CDS complement(754550..755500)
/locus_tag="B1761_04020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019786610.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosomal RNA small subunit methyltransferase H"
/protein_id="AQW33526.1"
gene complement(755667..756080)
/locus_tag="B1761_04025"
/pseudo
CDS complement(755667..756080)
/locus_tag="B1761_04025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681585.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(756272..756659)
/locus_tag="B1761_04030"
/pseudo
CDS complement(756272..756659)
/locus_tag="B1761_04030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621935.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(757296..757652)
/locus_tag="B1761_04035"
CDS complement(757296..757652)
/locus_tag="B1761_04035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226513.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF805 domain-containing protein"
/protein_id="AQW33527.1"
gene complement(758501..759751)
/locus_tag="B1761_04040"
CDS complement(758501..759751)
/locus_tag="B1761_04040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094634.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="gamma-glutamyl-phosphate reductase"
/protein_id="AQW33528.1"
gene complement(759753..760556)
/locus_tag="B1761_04045"
CDS complement(759753..760556)
/locus_tag="B1761_04045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535530.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamate 5-kinase"
/protein_id="AQW33529.1"
gene complement(760677..762266)
/locus_tag="B1761_04050"
CDS complement(760677..762266)
/locus_tag="B1761_04050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226516.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW33530.1"
gene complement(762269..763000)
/locus_tag="B1761_04055"
CDS complement(762269..763000)
/locus_tag="B1761_04055"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018163965.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-dehydroquinate dehydratase"
/protein_id="AQW33531.1"
gene 763275..764006
/locus_tag="B1761_04060"
CDS 763275..764006
/locus_tag="B1761_04060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535535.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33532.1"
gene complement(764358..768011)
/locus_tag="B1761_04065"
CDS complement(764358..768011)
/locus_tag="B1761_04065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884508.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="helicase-exonuclease AddAB subunit AddA"
/protein_id="AQW33533.1"
gene complement(768001..771321)
/locus_tag="B1761_04070"
CDS complement(768001..771321)
/locus_tag="B1761_04070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727688.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-dependent nuclease subunit B"
/protein_id="AQW33534.1"
gene complement(771812..772508)
/locus_tag="B1761_04075"
/pseudo
CDS complement(771812..772508)
/locus_tag="B1761_04075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183427.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(772513..772946)
/locus_tag="B1761_04080"
/pseudo
CDS complement(772513..772946)
/locus_tag="B1761_04080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012130780.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
gene complement(773164..773784)
/locus_tag="B1761_04085"
CDS complement(773164..773784)
/locus_tag="B1761_04085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948832.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33535.1"
gene complement(774246..775112)
/locus_tag="B1761_04090"
CDS complement(774246..775112)
/locus_tag="B1761_04090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226525.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33536.1"
gene complement(775099..775269)
/locus_tag="B1761_04095"
CDS complement(775099..775269)
/locus_tag="B1761_04095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951871.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA primase"
/protein_id="AQW33537.1"
gene complement(775388..776773)
/locus_tag="B1761_04100"
CDS complement(775388..776773)
/locus_tag="B1761_04100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891795.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="haloacid dehalogenase"
/protein_id="AQW33538.1"
gene 776847..777812
/locus_tag="B1761_04105"
CDS 776847..777812
/locus_tag="B1761_04105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019779390.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="L-asparaginase"
/protein_id="AQW34533.1"
gene complement(778581..780599)
/locus_tag="B1761_04110"
CDS complement(778581..780599)
/locus_tag="B1761_04110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608687.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA helicase RecG"
/protein_id="AQW33539.1"
gene complement(780728..781831)
/locus_tag="B1761_04115"
CDS complement(780728..781831)
/locus_tag="B1761_04115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226530.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alanine racemase"
/protein_id="AQW33540.1"
gene complement(781852..782211)
/locus_tag="B1761_04120"
CDS complement(781852..782211)
/locus_tag="B1761_04120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951878.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="holo-ACP synthase"
/protein_id="AQW33541.1"
gene complement(782215..783246)
/locus_tag="B1761_04125"
CDS complement(782215..783246)
/locus_tag="B1761_04125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227537.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-deoxy-7-phosphoheptulonate synthase"
/protein_id="AQW33542.1"
gene complement(783344..784375)
/locus_tag="B1761_04130"
CDS complement(783344..784375)
/locus_tag="B1761_04130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009854880.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-deoxy-7-phosphoheptulonate synthase"
/protein_id="AQW33543.1"
gene complement(784399..786948)
/locus_tag="B1761_04135"
CDS complement(784399..786948)
/locus_tag="B1761_04135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094665.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="protein translocase subunit SecA"
/protein_id="AQW33544.1"
gene complement(787131..787388)
/locus_tag="B1761_04140"
CDS complement(787131..787388)
/locus_tag="B1761_04140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947702.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33545.1"
gene complement(787475..788422)
/locus_tag="B1761_04145"
CDS complement(787475..788422)
/locus_tag="B1761_04145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094273.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="mannose-6-phosphate isomerase, class I"
/protein_id="AQW33546.1"
gene complement(788488..789381)
/locus_tag="B1761_04150"
CDS complement(788488..789381)
/locus_tag="B1761_04150"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227540.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="fructokinase/branched chain amino
acid--2-keto-4-methylthiobutyrate aminotransferase"
/protein_id="AQW33547.1"
gene complement(789565..791466)
/locus_tag="B1761_04155"
CDS complement(789565..791466)
/locus_tag="B1761_04155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608688.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PTS beta-glucoside transporter subunit EIIBCA"
/protein_id="AQW33548.1"
gene 791715..793157
/locus_tag="B1761_04160"
CDS 791715..793157
/locus_tag="B1761_04160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991171.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sucrose-6-phosphate hydrolase"
/protein_id="AQW33549.1"
gene 793166..794131
/locus_tag="B1761_04165"
CDS 793166..794131
/locus_tag="B1761_04165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015911853.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LacI family transcriptional regulator"
/protein_id="AQW33550.1"
gene complement(794221..794655)
/locus_tag="B1761_04170"
CDS complement(794221..794655)
/locus_tag="B1761_04170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889259.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N utilization substance protein B"
/protein_id="AQW33551.1"
gene complement(794648..795037)
/locus_tag="B1761_04175"
CDS complement(794648..795037)
/locus_tag="B1761_04175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014335250.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33552.1"
gene complement(795108..795668)
/locus_tag="B1761_04180"
CDS complement(795108..795668)
/locus_tag="B1761_04180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000568636.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="elongation factor P"
/protein_id="AQW33553.1"
gene complement(795781..796236)
/locus_tag="B1761_04185"
CDS complement(795781..796236)
/locus_tag="B1761_04185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951893.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein ComE"
/protein_id="AQW33554.1"
gene complement(796255..797316)
/locus_tag="B1761_04190"
CDS complement(796255..797316)
/locus_tag="B1761_04190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681620.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase M24 family protein"
/protein_id="AQW33555.1"
gene complement(797505..797933)
/locus_tag="B1761_04195"
CDS complement(797505..797933)
/locus_tag="B1761_04195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951896.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33556.1"
gene complement(797978..798538)
/locus_tag="B1761_04200"
CDS complement(797978..798538)
/locus_tag="B1761_04200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608689.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW34534.1"
gene complement(798540..798929)
/locus_tag="B1761_04205"
CDS complement(798540..798929)
/locus_tag="B1761_04205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621956.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW33557.1"
gene complement(799117..799308)
/locus_tag="B1761_04210"
CDS complement(799117..799308)
/locus_tag="B1761_04210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946571.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33558.1"
gene complement(799470..799742)
/locus_tag="B1761_04215"
CDS complement(799470..799742)
/locus_tag="B1761_04215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946573.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33559.1"
gene complement(799836..802661)
/locus_tag="B1761_04220"
CDS complement(799836..802661)
/locus_tag="B1761_04220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013643408.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="excinuclease ABC subunit A"
/protein_id="AQW33560.1"
gene 802970..803914
/locus_tag="B1761_04225"
CDS 802970..803914
/locus_tag="B1761_04225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003078759.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="magnesium transporter"
/protein_id="AQW33561.1"
gene 803985..804656
/locus_tag="B1761_04230"
CDS 803985..804656
/locus_tag="B1761_04230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951902.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33562.1"
gene 804773..805654
/locus_tag="B1761_04235"
CDS 804773..805654
/locus_tag="B1761_04235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891843.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33563.1"
gene complement(805781..806020)
/locus_tag="B1761_04240"
CDS complement(805781..806020)
/locus_tag="B1761_04240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002983142.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S18"
/protein_id="AQW33564.1"
gene complement(806062..806580)
/locus_tag="B1761_04245"
CDS complement(806062..806580)
/locus_tag="B1761_04245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003083754.1"
/note="binds to single stranded DNA and may facilitate the
binding and interaction of other proteins to DNA; Derived
by automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="single-stranded DNA-binding protein"
/protein_id="AQW33565.1"
gene complement(806592..806882)
/locus_tag="B1761_04250"
CDS complement(806592..806882)
/locus_tag="B1761_04250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018030687.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S6"
/protein_id="AQW33566.1"
gene 807101..808054
/locus_tag="B1761_04255"
/pseudo
CDS 807101..808054
/locus_tag="B1761_04255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951907.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 808594..809745
/locus_tag="B1761_04260"
CDS 808594..809745
/locus_tag="B1761_04260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951908.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="A/G-specific adenine glycosylase"
/protein_id="AQW33567.1"
gene complement(810072..810323)
/locus_tag="B1761_04265"
CDS complement(810072..810323)
/locus_tag="B1761_04265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227553.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33568.1"
gene complement(810426..810653)
/locus_tag="B1761_04270"
CDS complement(810426..810653)
/locus_tag="B1761_04270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681629.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33569.1"
gene complement(810640..810984)
/locus_tag="B1761_04275"
CDS complement(810640..810984)
/locus_tag="B1761_04275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227554.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33570.1"
gene complement(811572..814211)
/locus_tag="B1761_04280"
CDS complement(811572..814211)
/locus_tag="B1761_04280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621959.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase I"
/protein_id="AQW33571.1"
gene 814418..816769
/locus_tag="B1761_04285"
CDS 814418..816769
/locus_tag="B1761_04285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621960.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="endonuclease MutS2"
/protein_id="AQW33572.1"
gene complement(816870..817412)
/locus_tag="B1761_04290"
CDS complement(816870..817412)
/locus_tag="B1761_04290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535618.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="colicin V production protein"
/protein_id="AQW33573.1"
gene complement(817409..817726)
/locus_tag="B1761_04295"
CDS complement(817409..817726)
/locus_tag="B1761_04295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947863.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33574.1"
gene 818040..818930
/locus_tag="B1761_04300"
CDS 818040..818930
/locus_tag="B1761_04300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183555.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease HIII"
/protein_id="AQW33575.1"
gene 818949..819572
/locus_tag="B1761_04305"
CDS 818949..819572
/locus_tag="B1761_04305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889298.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="signal peptidase I"
/protein_id="AQW33576.1"
gene 819634..822138
/locus_tag="B1761_04310"
CDS 819634..822138
/locus_tag="B1761_04310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951919.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="exodeoxyribonuclease V subunit alpha"
/protein_id="AQW33577.1"
gene complement(822193..822519)
/locus_tag="B1761_04315"
CDS complement(822193..822519)
/locus_tag="B1761_04315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226559.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="branched-chain amino acid permease"
/protein_id="AQW33578.1"
gene complement(822506..823180)
/locus_tag="B1761_04320"
CDS complement(822506..823180)
/locus_tag="B1761_04320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003089415.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="branched-chain amino acid transporter AzlC"
/protein_id="AQW34535.1"
gene complement(823253..824266)
/locus_tag="B1761_04325"
CDS complement(823253..824266)
/locus_tag="B1761_04325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535624.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA
(adenosine(37)-N6)-threonylcarbamoyltransferase complex
transferase subunit TsaD"
/protein_id="AQW33579.1"
gene complement(824266..824721)
/locus_tag="B1761_04330"
CDS complement(824266..824721)
/locus_tag="B1761_04330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891902.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosomal-protein-alanine N-acetyltransferase
RimI"
/protein_id="AQW33580.1"
gene complement(824681..825367)
/locus_tag="B1761_04335"
CDS complement(824681..825367)
/locus_tag="B1761_04335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681639.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA
(adenosine(37)-N6)-threonylcarbamoyltransferase complex
dimerization subunit type 1 TsaB"
/protein_id="AQW33581.1"
gene 825630..825860
/locus_tag="B1761_04340"
CDS 825630..825860
/locus_tag="B1761_04340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019313841.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33582.1"
gene 825865..827547
/locus_tag="B1761_04345"
CDS 825865..827547
/locus_tag="B1761_04345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681640.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease J"
/protein_id="AQW33583.1"
gene complement(827783..828163)
/locus_tag="B1761_04350"
CDS complement(827783..828163)
/locus_tag="B1761_04350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608704.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CHAP domain-containing protein"
/protein_id="AQW33584.1"
gene complement(828377..829720)
/locus_tag="B1761_04355"
CDS complement(828377..829720)
/locus_tag="B1761_04355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003096012.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type I glutamate--ammonia ligase"
/protein_id="AQW33585.1"
gene complement(829769..830143)
/locus_tag="B1761_04360"
CDS complement(829769..830143)
/locus_tag="B1761_04360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226565.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MerR family transcriptional regulator"
/protein_id="AQW33586.1"
gene complement(830316..830819)
/locus_tag="B1761_04365"
CDS complement(830316..830819)
/locus_tag="B1761_04365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681643.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33587.1"
gene 831243..831872
/locus_tag="B1761_04370"
/pseudo
CDS 831243..831872
/locus_tag="B1761_04370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002296233.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(831945..833144)
/locus_tag="B1761_04375"
CDS complement(831945..833144)
/locus_tag="B1761_04375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001096748.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoglycerate kinase"
/protein_id="AQW33588.1"
gene complement(833401..833649)
/locus_tag="B1761_04380"
CDS complement(833401..833649)
/locus_tag="B1761_04380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947152.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS200/IS605 family transposase"
/protein_id="AQW33589.1"
gene 833764..834048
/locus_tag="B1761_04385"
CDS 833764..834048
/locus_tag="B1761_04385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226570.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33590.1"
gene 834111..834299
/locus_tag="B1761_04390"
CDS 834111..834299
/locus_tag="B1761_04390"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33591.1"
gene 834275..834613
/locus_tag="B1761_04395"
CDS 834275..834613
/locus_tag="B1761_04395"
/inference="COORDINATES: protein motif:HMM:PF13276.4"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33592.1"
gene 834627..835085
/locus_tag="B1761_04400"
CDS 834627..835085
/locus_tag="B1761_04400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680582.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33593.1"
gene 835197..836452
/locus_tag="B1761_04405"
/pseudo
CDS 835197..836452
/locus_tag="B1761_04405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621432.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene complement(836487..837497)
/locus_tag="B1761_04410"
CDS complement(836487..837497)
/locus_tag="B1761_04410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008090210.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type I glyceraldehyde-3-phosphate dehydrogenase"
/protein_id="AQW33594.1"
gene complement(837684..839765)
/locus_tag="B1761_04415"
CDS complement(837684..839765)
/locus_tag="B1761_04415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018374688.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="elongation factor G"
/protein_id="AQW33595.1"
gene complement(839986..840456)
/locus_tag="B1761_04420"
CDS complement(839986..840456)
/locus_tag="B1761_04420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011285383.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S7"
/protein_id="AQW33596.1"
gene complement(840475..840888)
/locus_tag="B1761_04425"
CDS complement(840475..840888)
/locus_tag="B1761_04425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001142328.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S12"
/protein_id="AQW33597.1"
gene complement(841105..841929)
/locus_tag="B1761_04430"
CDS complement(841105..841929)
/locus_tag="B1761_04430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227567.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pur operon repressor"
/protein_id="AQW33598.1"
gene complement(842023..842964)
/locus_tag="B1761_04435"
CDS complement(842023..842964)
/locus_tag="B1761_04435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681651.1"
/note="catalyzes the exonucleic cleavage of mRNA yielding
nucleioside 5'-phosphates; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="3'-5' exoribonuclease YhaM"
/protein_id="AQW33599.1"
gene complement(842954..844228)
/locus_tag="B1761_04440"
CDS complement(842954..844228)
/locus_tag="B1761_04440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946602.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="recombinase RmuC"
/protein_id="AQW33600.1"
gene complement(844230..844862)
/locus_tag="B1761_04445"
CDS complement(844230..844862)
/locus_tag="B1761_04445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951956.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thiamine pyrophosphokinase"
/protein_id="AQW33601.1"
gene complement(844855..845514)
/locus_tag="B1761_04450"
CDS complement(844855..845514) /locus_tag="B1761_04450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002884311.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribulose-phosphate 3-epimerase"
/protein_id="AQW33602.1"
gene complement(845522..846394)
/locus_tag="B1761_04455"
CDS complement(845522..846394)
/locus_tag="B1761_04455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018164844.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosome small subunit-dependent GTPase A"
/protein_id="AQW33603.1"
gene 846530..846612
/locus_tag="B1761_04460"
tRNA 846530..846612
/locus_tag="B1761_04460"
/product="tRNA-Leu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:846563..846565,aa:Leu,seq:cag)
gene complement(846651..847523)
/locus_tag="B1761_04465"
CDS complement(846651..847523)
/locus_tag="B1761_04465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535644.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosomal RNA small subunit methyltransferase A"
/protein_id="AQW33604.1"
gene complement(847668..848228)
/locus_tag="B1761_04470"
CDS complement(847668..848228)
/locus_tag="B1761_04470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681655.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease M5"
/protein_id="AQW33605.1"
gene complement(848221..848997)
/locus_tag="B1761_04475"
CDS complement(848221..848997)
/locus_tag="B1761_04475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227570.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hydrolase TatD"
/protein_id="AQW33606.1"
gene complement(849051..849482)
/locus_tag="B1761_04480"
CDS complement(849051..849482)
/locus_tag="B1761_04480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951969.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CoA-binding protein"
/protein_id="AQW33607.1"
gene complement(849542..849856)
/locus_tag="B1761_04485"
CDS complement(849542..849856)
/locus_tag="B1761_04485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094631.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thiol reductase thioredoxin"
/protein_id="AQW33608.1"
gene 850052..850834
/locus_tag="B1761_04490"
CDS 850052..850834
/locus_tag="B1761_04490"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226585.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33609.1"
gene complement(851295..851630)
/locus_tag="B1761_04495"
CDS complement(851295..851630)
/locus_tag="B1761_04495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093945.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thiol reductase thioredoxin"
/protein_id="AQW33610.1"
gene complement(851737..851810)
/locus_tag="B1761_04500"
tRNA complement(851737..851810)
/locus_tag="B1761_04500"
/product="tRNA-Asn"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(851774..851776),aa:Asn,seq:gtt)
gene complement(851816..851931)
/gene="rrf"
/locus_tag="B1761_04505"
rRNA complement(851816..851931)
/gene="rrf"
/locus_tag="B1761_04505"
/product="5S ribosomal RNA"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00001"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00001"
gene complement(852014..854915)
/locus_tag="B1761_04510"
rRNA complement(852014..854915)
/locus_tag="B1761_04510"
/product="23S ribosomal RNA"
gene complement(855062..855134)
/locus_tag="B1761_04515"
tRNA complement(855062..855134)
/locus_tag="B1761_04515"
/product="tRNA-Ala"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(855099..855101),aa:Ala,seq:tgc)
gene complement(855181..856735)
/locus_tag="B1761_04520"
rRNA complement(855181..856735)
/locus_tag="B1761_04520"
/product="16S ribosomal RNA"
gene complement(857457..858599)
/locus_tag="B1761_04525"
CDS complement(857457..858599)
/locus_tag="B1761_04525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004298827.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA guanosine(34) transglycosylase Tgt"
/protein_id="AQW33611.1"
gene complement(858853..859326)
/locus_tag="B1761_04530"
CDS complement(858853..859326)
/locus_tag="B1761_04530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891552.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS200/IS605 family transposase"
/protein_id="AQW33612.1"
gene complement(859504..859638)
/locus_tag="B1761_04535"
CDS complement(859504..859638)
/locus_tag="B1761_04535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000831903.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L34"
/protein_id="AQW33613.1"
gene complement(860100..860313)
/locus_tag="B1761_04540"
/pseudo
CDS complement(860100..860313)
/locus_tag="B1761_04540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953514.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="NADPH:quinone reductase"
gene complement(860524..861573)
/locus_tag="B1761_04545"
CDS complement(860524..861573)
/locus_tag="B1761_04545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621977.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="protein jag"
/protein_id="AQW33614.1"
gene complement(861585..862391)
/locus_tag="B1761_04550"
CDS complement(861585..862391)
/locus_tag="B1761_04550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014635083.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33615.1"
gene complement(862506..862841)
/locus_tag="B1761_04555"
CDS complement(862506..862841)
/locus_tag="B1761_04555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888723.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease P protein component"
/protein_id="AQW33616.1"
gene complement(862926..864311)
/locus_tag="B1761_04560"
CDS complement(862926..864311)
/locus_tag="B1761_04560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608717.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="argininosuccinate lyase"
/protein_id="AQW33617.1"
gene complement(864640..865839)
/locus_tag="B1761_04565"
CDS complement(864640..865839)
/locus_tag="B1761_04565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888721.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="argininosuccinate synthase"
/protein_id="AQW33618.1"
gene complement(866742..868196)
/locus_tag="B1761_04570"
CDS complement(866742..868196)
/locus_tag="B1761_04570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727712.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamate--tRNA ligase"
/protein_id="AQW33619.1"
gene complement(868378..868980)
/locus_tag="B1761_04575"
/pseudo
CDS complement(868378..868980)
/locus_tag="B1761_04575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001851766.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptide-binding protein"
gene complement(869007..869432)
/locus_tag="B1761_04580"
CDS complement(869007..869432)
/locus_tag="B1761_04580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953534.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter substrate-binding
protein"
/protein_id="AQW33620.1"
gene complement(869524..870213)
/locus_tag="B1761_04585"
CDS complement(869524..870213)
/locus_tag="B1761_04585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006145049.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L1"
/protein_id="AQW33621.1"
gene complement(870313..870738)
/locus_tag="B1761_04590"
CDS complement(870313..870738)
/locus_tag="B1761_04590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004226069.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L11"
/protein_id="AQW33622.1"
gene 870910..871263
/locus_tag="B1761_04595"
CDS 870910..871263
/locus_tag="B1761_04595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608721.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33623.1"
gene complement(871355..871852)
/locus_tag="B1761_04600"
CDS complement(871355..871852)
/locus_tag="B1761_04600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947059.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="carbonate dehydratase"
/protein_id="AQW33624.1"
gene complement(871995..872691)
/locus_tag="B1761_04605"
/pseudo
CDS complement(871995..872691)
/locus_tag="B1761_04605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888711.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="TIGR00266 family protein"
gene complement(872780..874141)
/locus_tag="B1761_04610"
CDS complement(872780..874141)
/locus_tag="B1761_04610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_010921866.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA repair protein RadA"
/protein_id="AQW33625.1"
gene complement(874319..874765)
/locus_tag="B1761_04615"
CDS complement(874319..874765)
/locus_tag="B1761_04615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947069.1"
/note="catalyzes the formation of dUMP from dUTP; Derived
by automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="deoxyuridine 5'-triphosphate
nucleotidohydrolase"
/protein_id="AQW33626.1"
gene 874979..875581
/locus_tag="B1761_04620"
/pseudo
CDS 874979..875581
/locus_tag="B1761_04620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017770348.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="NADPH-dependent FMN reductase"
gene 875600..876570
/locus_tag="B1761_04625"
/pseudo
CDS 875600..876570
/locus_tag="B1761_04625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991238.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="NADPH-dependent FMN reductase"
gene 876777..876959
/locus_tag="B1761_04630"
CDS 876777..876959
/locus_tag="B1761_04630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947076.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nitrite transporter"
/protein_id="AQW33627.1"
gene 877146..877478
/locus_tag="B1761_04635"
CDS 877146..877478
/locus_tag="B1761_04635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608726.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="formate transporter"
/protein_id="AQW33628.1"
gene 877487..877942
/locus_tag="B1761_04640"
CDS 877487..877942
/locus_tag="B1761_04640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226600.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33629.1"
gene 878174..879196
/locus_tag="B1761_04645"
CDS 878174..879196
/locus_tag="B1761_04645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953552.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycerol-3-phosphate dehydrogenase"
/protein_id="AQW33630.1"
gene 879215..880129
/locus_tag="B1761_04650"
CDS 879215..880129
/locus_tag="B1761_04650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621993.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UTP--glucose-1-phosphate uridylyltransferase"
/protein_id="AQW33631.1"
gene complement(880192..881061)
/locus_tag="B1761_04655"
CDS complement(880192..881061)
/locus_tag="B1761_04655"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681054.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33632.1"
gene complement(881076..881762)
/locus_tag="B1761_04660"
CDS complement(881076..881762)
/locus_tag="B1761_04660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681053.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33633.1"
gene complement(881862..882536)
/locus_tag="B1761_04665"
CDS complement(881862..882536)
/locus_tag="B1761_04665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226604.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="rhomboid family intramembrane serine protease"
/protein_id="AQW33634.1"
gene complement(882527..883054)
/locus_tag="B1761_04670"
CDS complement(882527..883054)
/locus_tag="B1761_04670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621995.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="5-formyltetrahydrofolate cyclo-ligase"
/protein_id="AQW33635.1"
gene complement(883123..884256)
/locus_tag="B1761_04675"
CDS complement(883123..884256)
/locus_tag="B1761_04675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002951995.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetyldiaminopimelate deacetylase"
/protein_id="AQW33636.1"
gene complement(884335..885033)
/locus_tag="B1761_04680"
CDS complement(884335..885033)
/locus_tag="B1761_04680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017768831.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2,3,4,5-tetrahydropyridine-2,6-dicarboxylate
N-acetyltransferase"
/protein_id="AQW33637.1"
gene complement(885119..885523)
/locus_tag="B1761_04685"
/pseudo
CDS complement(885119..885523)
/locus_tag="B1761_04685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226606.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(885517..885888)
/locus_tag="B1761_04690"
CDS complement(885517..885888)
/locus_tag="B1761_04690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608732.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="haloacid dehalogenase"
/protein_id="AQW33638.1"
gene complement(885988..886821)
/locus_tag="B1761_04695"
CDS complement(885988..886821)
/locus_tag="B1761_04695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608733.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="rRNA (guanine-N1)-methyltransferase"
/protein_id="AQW33639.1"
gene complement(886828..886926)
/gene="ffs"
/locus_tag="B1761_04700"
ncRNA complement(886828..886926)
/ncRNA_class="SRP_RNA"
/gene="ffs"
/locus_tag="B1761_04700"
/product="signal recognition particle sRNA small type"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00169"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00169"
gene 887190..887357
/locus_tag="B1761_04705"
CDS 887190..887357
/locus_tag="B1761_04705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002945733.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin"
/protein_id="AQW33640.1"
gene 887410..887673
/locus_tag="B1761_04710"
CDS 887410..887673
/locus_tag="B1761_04710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608734.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33641.1"
gene complement(887754..888272)
/locus_tag="B1761_04715"
CDS complement(887754..888272)
/locus_tag="B1761_04715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095914.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA-specific adenosine deaminase"
/protein_id="AQW33642.1"
gene complement(889032..889424)
/locus_tag="B1761_04720"
CDS complement(889032..889424)
/locus_tag="B1761_04720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002313215.1"
/note="binds to single stranded DNA and may facilitate the
binding and interaction of other proteins to DNA; Derived
by automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="single-stranded DNA-binding protein"
/protein_id="AQW33643.1"
gene complement(889630..889857)
/locus_tag="B1761_04725"
CDS complement(889630..889857)
/locus_tag="B1761_04725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887422.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="oxidoreductase"
/protein_id="AQW33644.1"
gene complement(889872..890903)
/locus_tag="B1761_04730"
CDS complement(889872..890903)
/locus_tag="B1761_04730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018364601.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33645.1"
gene complement(891040..891663)
/locus_tag="B1761_04735"
CDS complement(891040..891663)
/locus_tag="B1761_04735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227581.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA-binding protein"
/protein_id="AQW33646.1"
gene complement(891673..891987)
/locus_tag="B1761_04740"
CDS complement(891673..891987)
/locus_tag="B1761_04740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226613.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thiol reductase thioredoxin"
/protein_id="AQW33647.1"
gene complement(891984..892268)
/locus_tag="B1761_04745"
CDS complement(891984..892268)
/locus_tag="B1761_04745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003091918.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33648.1"
gene 892368..893435
/locus_tag="B1761_04750"
CDS 892368..893435
/locus_tag="B1761_04750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887007.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamyl aminopeptidase"
/protein_id="AQW33649.1"
gene 893451..894221
/locus_tag="B1761_04755"
CDS 893451..894221
/locus_tag="B1761_04755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008536128.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pyrroline-5-carboxylate reductase"
/protein_id="AQW33650.1"
gene complement(894251..894913)
/locus_tag="B1761_04760"
CDS complement(894251..894913)
/locus_tag="B1761_04760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095899.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CPBP family intramembrane metalloprotease"
/protein_id="AQW33651.1"
gene complement(895010..895453)
/locus_tag="B1761_04765"
CDS complement(895010..895453)
/locus_tag="B1761_04765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946118.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CAAX protease"
/protein_id="AQW33652.1"
gene complement(895527..895952)
/locus_tag="B1761_04770"
CDS complement(895527..895952)
/locus_tag="B1761_04770"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608739.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CPBP family intramembrane metalloprotease"
/protein_id="AQW33653.1"
gene complement(895909..896184)
/locus_tag="B1761_04775"
CDS complement(895909..896184)
/locus_tag="B1761_04775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681681.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CAAX protease"
/protein_id="AQW33654.1"
gene complement(896196..896393)
/locus_tag="B1761_04780"
CDS complement(896196..896393)
/locus_tag="B1761_04780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885716.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33655.1"
gene complement(896642..897835)
/locus_tag="B1761_04785"
CDS complement(896642..897835)
/locus_tag="B1761_04785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018164685.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetate kinase"
/protein_id="AQW33656.1"
gene complement(897891..898847)
/locus_tag="B1761_04790"
CDS complement(897891..898847)
/locus_tag="B1761_04790"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887012.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SAM-dependent methyltransferase"
/protein_id="AQW33657.1"
gene complement(898892..899209)
/locus_tag="B1761_04795"
CDS complement(898892..899209)
/locus_tag="B1761_04795"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952035.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein ComG"
/protein_id="AQW33658.1"
gene complement(899187..899624)
/locus_tag="B1761_04800"
CDS complement(899187..899624)
/locus_tag="B1761_04800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681686.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein ComGF"
/protein_id="AQW33659.1"
gene complement(899608..899901)
/locus_tag="B1761_04805"
CDS complement(899608..899901)
/locus_tag="B1761_04805"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227584.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein ComGE"
/protein_id="AQW33660.1"
gene complement(899873..900235)
/locus_tag="B1761_04810"
CDS complement(899873..900235)
/locus_tag="B1761_04810"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014622003.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein"
/protein_id="AQW33661.1"
gene complement(900261..900587)
/locus_tag="B1761_04815"
CDS complement(900261..900587)
/locus_tag="B1761_04815"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727724.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein ComGC"
/protein_id="AQW33662.1"
gene complement(900584..901474)
/locus_tag="B1761_04820"
CDS complement(900584..901474)
/locus_tag="B1761_04820"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681688.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein CglB"
/protein_id="AQW33663.1"
gene complement(901566..902507)
/locus_tag="B1761_04825"
CDS complement(901566..902507)
/locus_tag="B1761_04825"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885658.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein CglA"
/protein_id="AQW33664.1"
gene complement(902588..902950)
/locus_tag="B1761_04830"
CDS complement(902588..902950)
/locus_tag="B1761_04830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226630.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="superoxide dismutase"
/protein_id="AQW33665.1"
gene complement(903109..906747)
/locus_tag="B1761_04835"
CDS complement(903109..906747)
/locus_tag="B1761_04835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991269.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-directed RNA polymerase subunit beta'"
/protein_id="AQW33666.1"
gene complement(906848..910429)
/locus_tag="B1761_04840"
CDS complement(906848..910429)
/locus_tag="B1761_04840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014622007.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-directed RNA polymerase subunit beta"
/protein_id="AQW33667.1"
gene complement(910792..913215)
/locus_tag="B1761_04845"
CDS complement(910792..913215)
/locus_tag="B1761_04845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226632.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33668.1"
gene 913317..914573
/locus_tag="B1761_04850"
CDS 913317..914573
/locus_tag="B1761_04850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000546895.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Tyrosine--tRNA ligase 1"
/protein_id="AQW33669.1"
gene complement(914699..915721)
/locus_tag="B1761_04855"
CDS complement(914699..915721)
/locus_tag="B1761_04855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003010246.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ketol-acid reductoisomerase"
/protein_id="AQW33670.1"
gene complement(915797..916273)
/locus_tag="B1761_04860"
CDS complement(915797..916273)
/locus_tag="B1761_04860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002927678.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetolactate synthase small subunit"
/protein_id="AQW33671.1"
gene complement(916266..917966)
/locus_tag="B1761_04865"
CDS complement(916266..917966)
/locus_tag="B1761_04865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000411249.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetolactate synthase, large subunit,
biosynthetic type"
/protein_id="AQW33672.1"
gene complement(918100..919689)
/locus_tag="B1761_04870"
CDS complement(918100..919689)
/locus_tag="B1761_04870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608750.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydroxy-acid dehydratase"
/protein_id="AQW33673.1"
gene complement(919990..921657)
/locus_tag="B1761_04875"
CDS complement(919990..921657)
/locus_tag="B1761_04875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000036699.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33674.1"
gene complement(921657..922022)
/locus_tag="B1761_04880"
CDS complement(921657..922022)
/locus_tag="B1761_04880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018374983.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33675.1"
gene complement(922132..923421)
/locus_tag="B1761_04885"
CDS complement(922132..923421)
/locus_tag="B1761_04885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727732.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MATE family efflux transporter"
/protein_id="AQW33676.1"
gene complement(923479..924963)
/locus_tag="B1761_04890"
CDS complement(923479..924963)
/locus_tag="B1761_04890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006595200.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="threonine synthase"
/protein_id="AQW33677.1"
gene complement(925143..925325)
/locus_tag="B1761_04895"
CDS complement(925143..925325)
/locus_tag="B1761_04895"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33678.1"
gene complement(925634..925972)
/locus_tag="B1761_04900"
CDS complement(925634..925972)
/locus_tag="B1761_04900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952081.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aldehyde dehydrogenase"
/protein_id="AQW33679.1"
gene complement(925965..926198)
/locus_tag="B1761_04905"
CDS complement(925965..926198)
/locus_tag="B1761_04905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952083.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aldehyde dehydrogenase"
/protein_id="AQW33680.1"
gene complement(926182..926616)
/locus_tag="B1761_04910"
CDS complement(926182..926616)
/locus_tag="B1761_04910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952086.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alcohol dehydrogenase"
/protein_id="AQW34536.1"
gene complement(926629..927456)
/locus_tag="B1761_04915"
CDS complement(926629..927456)
/locus_tag="B1761_04915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014622019.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alcohol dehydrogenase"
/protein_id="AQW33681.1"
gene complement(927766..928161)
/locus_tag="B1761_04920"
CDS complement(927766..928161)
/locus_tag="B1761_04920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952089.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aldehyde dehydrogenase"
/protein_id="AQW33682.1"
gene complement(928300..930195)
/locus_tag="B1761_04925"
CDS complement(928300..930195)
/locus_tag="B1761_04925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018163711.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="endopeptidase"
/protein_id="AQW33683.1"
gene complement(930276..931428)
/locus_tag="B1761_04930"
/pseudo
CDS complement(930276..931428)
/locus_tag="B1761_04930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885868.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(931495..932231)
/locus_tag="B1761_04935"
/pseudo
CDS complement(931495..932231)
/locus_tag="B1761_04935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014635133.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="PTS sucrose transporter subunit IIABC"
gene 932577..932735
/locus_tag="B1761_04940"
CDS 932577..932735
/locus_tag="B1761_04940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952104.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GntR family transcriptional regulator"
/protein_id="AQW33684.1"
gene 932790..933287
/locus_tag="B1761_04945"
CDS 932790..933287
/locus_tag="B1761_04945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727734.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33685.1"
gene complement(933343..933903)
/locus_tag="B1761_04950"
CDS complement(933343..933903)
/locus_tag="B1761_04950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014635136.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="TIGR01440 family protein"
/protein_id="AQW33686.1"
gene complement(933916..934254)
/locus_tag="B1761_04955"
CDS complement(933916..934254)
/locus_tag="B1761_04955"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681703.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33687.1"
gene complement(934287..934643)
/locus_tag="B1761_04960"
CDS complement(934287..934643)
/locus_tag="B1761_04960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885732.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33688.1"
gene 934907..935194
/locus_tag="B1761_04965"
CDS 934907..935194
/locus_tag="B1761_04965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952116.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33689.1"
gene 935211..935898
/locus_tag="B1761_04970"
/pseudo
CDS 935211..935898
/locus_tag="B1761_04970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727745.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS30 family transposase"
gene complement(936409..937563)
/locus_tag="B1761_04975"
CDS complement(936409..937563)
/locus_tag="B1761_04975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948393.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CAAX protease"
/protein_id="AQW34537.1"
gene 938082..939296
/locus_tag="B1761_04980"
CDS 938082..939296
/locus_tag="B1761_04980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608769.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dicarboxylate/amino acid:cation symporter"
/protein_id="AQW33690.1"
gene 939316..940245
/locus_tag="B1761_04985"
CDS 939316..940245
/locus_tag="B1761_04985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608770.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alpha-L-glutamate ligase"
/protein_id="AQW33691.1"
gene complement(940871..941074)
/locus_tag="B1761_04990"
CDS complement(940871..941074)
/locus_tag="B1761_04990"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608772.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33692.1"
gene complement(941077..941412)
/locus_tag="B1761_04995"
CDS complement(941077..941412)
/locus_tag="B1761_04995"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608773.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33693.1"
gene complement(941396..942607)
/locus_tag="B1761_05000"
CDS complement(941396..942607)
/locus_tag="B1761_05000"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608774.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33694.1"
gene complement(942767..943060)
/locus_tag="B1761_05005"
CDS complement(942767..943060)
/locus_tag="B1761_05005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002918303.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33695.1"
gene complement(943053..943394)
/locus_tag="B1761_05010"
CDS complement(943053..943394)
/locus_tag="B1761_05010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000567224.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34538.1"
gene complement(943585..943956)
/locus_tag="B1761_05015"
CDS complement(943585..943956)
/locus_tag="B1761_05015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015260691.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33696.1"
gene 944162..944371
/locus_tag="B1761_05020"
CDS 944162..944371
/locus_tag="B1761_05020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608777.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33697.1"
gene 944537..944836
/locus_tag="B1761_05025"
CDS 944537..944836
/locus_tag="B1761_05025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608778.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33698.1"
gene complement(944876..946093)
/locus_tag="B1761_05030"
CDS complement(944876..946093)
/locus_tag="B1761_05030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727739.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="restriction endonuclease"
/protein_id="AQW33699.1"
gene complement(946102..946566)
/locus_tag="B1761_05035"
CDS complement(946102..946566)
/locus_tag="B1761_05035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608780.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33700.1"
gene 946834..948381
/locus_tag="B1761_05040"
CDS 946834..948381
/locus_tag="B1761_05040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006151093.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA cytosine methyltransferase"
/protein_id="AQW33701.1"
gene complement(948532..948831)
/locus_tag="B1761_05045"
CDS complement(948532..948831)
/locus_tag="B1761_05045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017649884.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33702.1"
gene complement(949076..949957)
/locus_tag="B1761_05050"
CDS complement(949076..949957)
/locus_tag="B1761_05050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001018994.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="fructose-1,6-bisphosphate aldolase, class II"
/protein_id="AQW33703.1"
gene complement(950105..950190)
/locus_tag="B1761_05055"
tRNA complement(950105..950190)
/locus_tag="B1761_05055"
/product="tRNA-Leu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(950154..950156),aa:Leu,seq:aag)
gene complement(950375..950980)
/locus_tag="B1761_05060"
CDS complement(950375..950980)
/locus_tag="B1761_05060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727741.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamate--cysteine ligase"
/protein_id="AQW33704.1"
gene complement(951038..951433)
/locus_tag="B1761_05065"
CDS complement(951038..951433)
/locus_tag="B1761_05065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952127.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33705.1"
gene complement(951530..951685)
/locus_tag="B1761_05070"
CDS complement(951530..951685)
/locus_tag="B1761_05070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953570.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamate--cysteine ligase"
/protein_id="AQW33706.1"
gene 951824..951958
/locus_tag="B1761_05075"
CDS 951824..951958
/locus_tag="B1761_05075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608785.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="helix-turn-helix domain containing protein"
/protein_id="AQW33707.1"
gene 952123..952809
/locus_tag="B1761_05080"
CDS 952123..952809
/locus_tag="B1761_05080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727745.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS30 family transposase"
/protein_id="AQW33708.1"
gene complement(953005..953391)
/locus_tag="B1761_05085"
CDS complement(953005..953391)
/locus_tag="B1761_05085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887523.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L17"
/protein_id="AQW33709.1"
gene complement(953409..954347)
/locus_tag="B1761_05090"
CDS complement(953409..954347)
/locus_tag="B1761_05090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000568977.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-directed RNA polymerase subunit alpha"
/protein_id="AQW33710.1"
gene complement(954396..954779)
/locus_tag="B1761_05095"
CDS complement(954396..954779)
/locus_tag="B1761_05095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003130556.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S11"
/protein_id="AQW33711.1"
gene complement(954807..955172)
/locus_tag="B1761_05100"
CDS complement(954807..955172)
/locus_tag="B1761_05100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008809894.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S13"
/protein_id="AQW33712.1"
gene complement(955190..955306)
/locus_tag="B1761_05105"
CDS complement(955190..955306)
/locus_tag="B1761_05105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013773089.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L36"
/protein_id="AQW33713.1"
gene complement(955332..955550)
/locus_tag="B1761_05110"
CDS complement(955332..955550)
/locus_tag="B1761_05110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003130554.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="translation initiation factor IF-1"
/protein_id="AQW33714.1"
gene complement(955668..956324)
/locus_tag="B1761_05115"
CDS complement(955668..956324)
/locus_tag="B1761_05115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001050422.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="adenylate kinase"
/protein_id="AQW33715.1"
gene complement(956456..957751)
/locus_tag="B1761_05120"
CDS complement(956456..957751)
/locus_tag="B1761_05120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727746.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="preprotein translocase subunit SecY"
/protein_id="AQW33716.1"
gene complement(957768..958208)
/locus_tag="B1761_05125"
CDS complement(957768..958208)
/locus_tag="B1761_05125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004225266.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L15"
/protein_id="AQW33717.1"
gene complement(958336..958518)
/locus_tag="B1761_05130"
CDS complement(958336..958518)
/locus_tag="B1761_05130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376783.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L30"
/protein_id="AQW33718.1"
gene complement(958533..959027)
/locus_tag="B1761_05135"
CDS complement(958533..959027)
/locus_tag="B1761_05135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376782.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S5"
/protein_id="AQW33719.1"
gene complement(959046..959411)
/locus_tag="B1761_05140"
CDS complement(959046..959411)
/locus_tag="B1761_05140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017794725.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L18"
/protein_id="AQW33720.1"
gene complement(959492..960028)
/locus_tag="B1761_05145"
CDS complement(959492..960028)
/locus_tag="B1761_05145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016399261.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L6"
/protein_id="AQW33721.1"
gene complement(960155..960553)
/locus_tag="B1761_05150"
CDS complement(960155..960553)
/locus_tag="B1761_05150"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009754342.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S8"
/protein_id="AQW33722.1"
gene complement(960676..960861)
/gene="rpsN"
/locus_tag="B1761_05155"
CDS complement(960676..960861)
/gene="rpsN"
/locus_tag="B1761_05155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011245027.1"
/note="located in the peptidyl transferase center and
involved in assembly of 30S ribosome subunit; similar to
what is observed with proteins L31 and L33, some proteins
in this family contain CXXC motifs that are involved in
zinc binding; if two copies are present in a genome, then
the duplicated copy appears to have lost the zinc-binding
motif and is instead regulated by zinc; the proteins in
this group appear to contain the zinc-binding motif;
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S14 type Z"
/protein_id="AQW33723.1"
gene complement(960879..961421)
/locus_tag="B1761_05160"
CDS complement(960879..961421)
/locus_tag="B1761_05160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376779.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L5"
/protein_id="AQW33724.1"
gene complement(961448..961753)
/locus_tag="B1761_05165"
CDS complement(961448..961753)
/locus_tag="B1761_05165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011921687.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L24"
/protein_id="AQW33725.1"
gene complement(961834..962202)
/locus_tag="B1761_05170"
CDS complement(961834..962202)
/locus_tag="B1761_05170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002460061.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L14"
/protein_id="AQW33726.1"
gene complement(962227..962487)
/locus_tag="B1761_05175"
CDS complement(962227..962487)
/locus_tag="B1761_05175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006738952.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S17"
/protein_id="AQW33727.1"
gene complement(962515..962721)
/locus_tag="B1761_05180"
CDS complement(962515..962721)
/locus_tag="B1761_05180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018369826.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L29"
/protein_id="AQW33728.1"
gene complement(962731..963144)
/locus_tag="B1761_05185"
CDS complement(962731..963144)
/locus_tag="B1761_05185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003029477.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L16"
/protein_id="AQW33729.1"
gene complement(963148..963801)
/locus_tag="B1761_05190"
CDS complement(963148..963801)
/locus_tag="B1761_05190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000529931.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S3"
/protein_id="AQW33730.1"
gene complement(963814..964158)
/locus_tag="B1761_05195"
CDS complement(963814..964158)
/locus_tag="B1761_05195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018371349.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L22"
/protein_id="AQW33731.1"
gene complement(964174..964452)
/locus_tag="B1761_05200"
CDS complement(964174..964452)
/locus_tag="B1761_05200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000533765.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S19"
/protein_id="AQW33732.1"
gene complement(964546..965379)
/locus_tag="B1761_05205"
CDS complement(964546..965379)
/locus_tag="B1761_05205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019790357.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L2"
/protein_id="AQW33733.1"
gene complement(965397..965693)
/locus_tag="B1761_05210"
CDS complement(965397..965693)
/locus_tag="B1761_05210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006739217.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L23"
/protein_id="AQW33734.1"
gene complement(965693..966316)
/locus_tag="B1761_05215"
CDS complement(965693..966316)
/locus_tag="B1761_05215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012677212.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L4"
/protein_id="AQW33735.1"
gene complement(966341..966967)
/locus_tag="B1761_05220"
CDS complement(966341..966967)
/locus_tag="B1761_05220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002986659.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L3"
/protein_id="AQW33736.1"
gene complement(967084..967392)
/locus_tag="B1761_05225"
CDS complement(967084..967392)
/locus_tag="B1761_05225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003046044.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S10"
/protein_id="AQW33737.1"
gene complement(967636..968637)
/locus_tag="B1761_05230"
CDS complement(967636..968637)
/locus_tag="B1761_05230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003086929.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Holliday junction branch migration DNA helicase
RuvB"
/protein_id="AQW33738.1"
gene complement(968720..970542)
/locus_tag="B1761_05235"
/pseudo
CDS complement(968720..970542)
/locus_tag="B1761_05235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948619.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="acetyltransferase"
gene complement(970539..970949)
/locus_tag="B1761_05240"
CDS complement(970539..970949)
/locus_tag="B1761_05240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952170.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33739.1"
gene complement(970946..971380)
/locus_tag="B1761_05245"
CDS complement(970946..971380)
/locus_tag="B1761_05245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952171.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="protein tyrosine phosphatase"
/protein_id="AQW33740.1"
gene complement(971663..972955)
/locus_tag="B1761_05250"
CDS complement(971663..972955)
/locus_tag="B1761_05250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006738906.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="adenylosuccinate synthetase"
/protein_id="AQW33741.1"
gene complement(973209..973724)
/locus_tag="B1761_05255"
CDS complement(973209..973724)
/locus_tag="B1761_05255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948623.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA topology modulation protein FlaR"
/protein_id="AQW33742.1"
gene 974453..975313
/locus_tag="B1761_05260"
CDS 974453..975313
/locus_tag="B1761_05260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608790.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MutR family transcriptional regulator"
/protein_id="AQW33743.1"
gene 975698..976753
/locus_tag="B1761_05265"
CDS 975698..976753
/locus_tag="B1761_05265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681724.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="radical SAM protein"
/protein_id="AQW33744.1"
gene 976746..978287
/locus_tag="B1761_05270"
CDS 976746..978287
/locus_tag="B1761_05270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014622049.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW33745.1"
gene complement(978691..979203)
/locus_tag="B1761_05275"
CDS complement(978691..979203)
/locus_tag="B1761_05275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003004059.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33746.1"
gene 979384..979566
/locus_tag="B1761_05280"
CDS 979384..979566
/locus_tag="B1761_05280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003009863.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33747.1"
gene 979612..979968
/locus_tag="B1761_05285"
CDS 979612..979968
/locus_tag="B1761_05285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681727.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="replication initiator protein"
/protein_id="AQW33748.1"
gene 979972..980589
/locus_tag="B1761_05290"
CDS 979972..980589
/locus_tag="B1761_05290"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33749.1"
gene 980601..980789
/locus_tag="B1761_05295"
CDS 980601..980789
/locus_tag="B1761_05295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000369785.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF3173 domain-containing protein"
/protein_id="AQW33750.1"
gene 980791..981930
/locus_tag="B1761_05300"
CDS 980791..981930
/locus_tag="B1761_05300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015605872.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="site-specific integrase"
/protein_id="AQW33751.1"
gene complement(982014..982089)
/locus_tag="B1761_05305"
tRNA complement(982014..982089)
/locus_tag="B1761_05305"
/product="tRNA-Lys"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(982054..982056),aa:Lys,seq:ctt)
gene complement(982090..982285)
/gene="ssrS"
/locus_tag="B1761_05310"
ncRNA complement(982090..982285)
/ncRNA_class="other"
/gene="ssrS"
/locus_tag="B1761_05310"
/product="6S RNA"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00013"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00013"
gene complement(982373..983641)
/locus_tag="B1761_05315"
CDS complement(982373..983641)
/locus_tag="B1761_05315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887077.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="recombinase RarA"
/protein_id="AQW33752.1"
gene 983811..983999
/locus_tag="B1761_05320"
CDS 983811..983999
/locus_tag="B1761_05320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008536053.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L28"
/protein_id="AQW33753.1"
gene 984126..984392
/locus_tag="B1761_05325"
CDS 984126..984392
/locus_tag="B1761_05325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885737.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33754.1"
gene 984392..984811
/locus_tag="B1761_05330"
CDS 984392..984811
/locus_tag="B1761_05330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003090938.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Holliday junction resolvase RuvX"
/protein_id="AQW33755.1"
gene 984920..985225
/locus_tag="B1761_05335"
CDS 984920..985225
/locus_tag="B1761_05335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681733.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33756.1"
gene 985438..987084
/locus_tag="B1761_05340"
CDS 985438..987084
/locus_tag="B1761_05340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952189.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33757.1"
gene 987193..989397
/locus_tag="B1761_05345"
CDS 987193..989397
/locus_tag="B1761_05345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885751.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="anaerobic ribonucleoside triphosphate reductase"
/protein_id="AQW33758.1"
gene 989630..990130
/locus_tag="B1761_05350"
CDS 989630..990130
/locus_tag="B1761_05350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003091923.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GNAT family acetyltransferase"
/protein_id="AQW33759.1"
gene 990135..990740
/locus_tag="B1761_05355"
CDS 990135..990740
/locus_tag="B1761_05355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002288706.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="anaerobic ribonucleoside-triphosphate reductase
activating protein"
/protein_id="AQW33760.1"
gene complement(990762..991531)
/locus_tag="B1761_05360"
/pseudo
CDS complement(990762..991531)
/locus_tag="B1761_05360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014622054.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(991591..992532)
/locus_tag="B1761_05365"
CDS complement(991591..992532)
/locus_tag="B1761_05365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226676.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33761.1"
gene complement(992525..994276)
/locus_tag="B1761_05370"
CDS complement(992525..994276)
/locus_tag="B1761_05370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885629.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartate--tRNA ligase"
/protein_id="AQW33762.1"
gene complement(994386..994808)
/locus_tag="B1761_05375"
CDS complement(994386..994808)
/locus_tag="B1761_05375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887483.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33763.1"
gene complement(994816..996096)
/locus_tag="B1761_05380"
CDS complement(994816..996096)
/locus_tag="B1761_05380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681741.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidine--tRNA ligase"
/protein_id="AQW33764.1"
gene complement(996154..996345)
/locus_tag="B1761_05385"
CDS complement(996154..996345)
/locus_tag="B1761_05385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002953609.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33765.1"
gene complement(996406..997143)
/locus_tag="B1761_05390"
/pseudo
CDS complement(996406..997143)
/locus_tag="B1761_05390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226678.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="5-methyltetrahydrofolate--homocysteine
methyltransferase"
gene complement(997291..997518)
/locus_tag="B1761_05395"
CDS complement(997291..997518)
/locus_tag="B1761_05395"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33766.1"
gene 997748..997930
/locus_tag="B1761_05400"
CDS 997748..997930
/locus_tag="B1761_05400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000290417.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L32"
/protein_id="AQW33767.1"
gene 997946..998095
/locus_tag="B1761_05405"
CDS 997946..998095
/locus_tag="B1761_05405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001265622.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L33"
/protein_id="AQW33768.1"
gene complement(998251..998805)
/locus_tag="B1761_05410"
CDS complement(998251..998805)
/locus_tag="B1761_05410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681743.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33769.1"
gene complement(998864..999250)
/locus_tag="B1761_05415"
/pseudo
CDS complement(998864..999250)
/locus_tag="B1761_05415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948033.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(999431..999745)
/locus_tag="B1761_05420"
/pseudo
CDS complement(999431..999745)
/locus_tag="B1761_05420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226683.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="diacylglycerol kinase"
gene complement(1000090..1000692)
/locus_tag="B1761_05425"
CDS complement(1000090..1000692)
/locus_tag="B1761_05425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002911572.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF389 domain-containing protein"
/protein_id="AQW33770.1"
gene complement(1000736..1001107)
/locus_tag="B1761_05430"
CDS complement(1000736..1001107)
/locus_tag="B1761_05430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952212.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33771.1"
gene 1001697..1001936
/locus_tag="B1761_05435"
CDS 1001697..1001936
/locus_tag="B1761_05435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009081680.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33772.1"
gene 1001999..1002565
/locus_tag="B1761_05440"
CDS 1001999..1002565
/locus_tag="B1761_05440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014293942.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33773.1"
gene 1002578..1002748
/locus_tag="B1761_05445"
CDS 1002578..1002748
/locus_tag="B1761_05445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002905455.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF2273 domain-containing protein"
/protein_id="AQW33774.1"
gene 1002763..1003320
/locus_tag="B1761_05450"
CDS 1002763..1003320
/locus_tag="B1761_05450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948043.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="general stress protein"
/protein_id="AQW33775.1"
gene 1003393..1003596
/locus_tag="B1761_05455"
CDS 1003393..1003596
/locus_tag="B1761_05455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681747.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CsbD family protein"
/protein_id="AQW33776.1"
gene complement(1004189..1004686)
/locus_tag="B1761_05460"
CDS complement(1004189..1004686)
/locus_tag="B1761_05460"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608797.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="coenzyme A pyrophosphatase"
/protein_id="AQW33777.1"
gene 1005027..1005179
/locus_tag="B1761_05465"
CDS 1005027..1005179
/locus_tag="B1761_05465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948048.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PadR family transcriptional regulator"
/protein_id="AQW33778.1"
gene 1005193..1005354
/locus_tag="B1761_05470"
CDS 1005193..1005354
/locus_tag="B1761_05470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948051.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PadR family transcriptional regulator"
/protein_id="AQW33779.1"
gene 1005341..1005898
/locus_tag="B1761_05475"
/pseudo
CDS 1005341..1005898
/locus_tag="B1761_05475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003103158.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1006015..1006770
/locus_tag="B1761_05480"
CDS 1006015..1006770
/locus_tag="B1761_05480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681749.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33780.1"
gene complement(1006807..1009176)
/locus_tag="B1761_05485"
CDS complement(1006807..1009176)
/locus_tag="B1761_05485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681750.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33781.1"
gene 1009305..1009844
/locus_tag="B1761_05490"
CDS 1009305..1009844
/locus_tag="B1761_05490"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952253.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="TetR family transcriptional regulator"
/protein_id="AQW33782.1"
gene complement(1009922..1010284)
/locus_tag="B1761_05495"
CDS complement(1009922..1010284)
/locus_tag="B1761_05495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681751.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33783.1"
gene complement(1010815..1011426)
/locus_tag="B1761_05500"
CDS complement(1010815..1011426)
/locus_tag="B1761_05500"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014407971.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S4"
/protein_id="AQW33784.1"
gene complement(1011624..1011926)
/locus_tag="B1761_05505"
CDS complement(1011624..1011926)
/locus_tag="B1761_05505"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952260.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33785.1"
gene complement(1011950..1013311)
/locus_tag="B1761_05510"
CDS complement(1011950..1013311)
/locus_tag="B1761_05510"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885809.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="replicative DNA helicase"
/protein_id="AQW33786.1"
gene complement(1013355..1013813)
/locus_tag="B1761_05515"
CDS complement(1013355..1013813)
/locus_tag="B1761_05515"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535997.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L9"
/protein_id="AQW33787.1"
gene complement(1013815..1015779)
/locus_tag="B1761_05520"
CDS complement(1013815..1015779)
/locus_tag="B1761_05520"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885784.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DHH family phosphoesterase"
/protein_id="AQW33788.1"
gene complement(1015853..1017754)
/locus_tag="B1761_05525"
CDS complement(1015853..1017754)
/locus_tag="B1761_05525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885840.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA uridine-5-carboxymethylaminomethyl(34)
synthesis enzyme MnmG"
/protein_id="AQW33789.1"
gene complement(1017763..1018218)
/locus_tag="B1761_05530"
CDS complement(1017763..1018218)
/locus_tag="B1761_05530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006595353.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NUDIX hydrolase"
/protein_id="AQW33790.1"
gene complement(1018483..1019604)
/locus_tag="B1761_05535"
CDS complement(1018483..1019604)
/locus_tag="B1761_05535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535986.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA 2-thiouridine(34) synthase MnmA"
/protein_id="AQW33791.1"
gene complement(1019743..1021458)
/locus_tag="B1761_05540"
CDS complement(1019743..1021458)
/locus_tag="B1761_05540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608800.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34539.1"
gene complement(1021560..1022189)
/locus_tag="B1761_05545"
CDS complement(1021560..1022189)
/locus_tag="B1761_05545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226700.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology." /codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33792.1"
gene complement(1022429..1022983)
/locus_tag="B1761_05550"
CDS complement(1022429..1022983)
/locus_tag="B1761_05550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226701.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidoglycan-binding protein LysM"
/protein_id="AQW33793.1"
gene complement(1023287..1024081)
/locus_tag="B1761_05555"
CDS complement(1023287..1024081)
/locus_tag="B1761_05555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226702.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="energy-coupling factor transporter protein EcfT"
/protein_id="AQW33794.1"
gene complement(1024074..1024916)
/locus_tag="B1761_05560"
CDS complement(1024074..1024916)
/locus_tag="B1761_05560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947774.1"
/note="with CbiNQ forms the ABC transporter for cobalt
import; Bacillus spp. have two adjacent copies of this
gene; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="energy-coupling factor transporter ATPase"
/protein_id="AQW33795.1"
gene complement(1024892..1025665)
/locus_tag="B1761_05565"
CDS complement(1024892..1025665)
/locus_tag="B1761_05565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535981.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="energy-coupling factor transporter ATPase"
/protein_id="AQW33796.1"
gene complement(1025734..1026276)
/locus_tag="B1761_05570"
CDS complement(1025734..1026276)
/locus_tag="B1761_05570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003107946.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CDP-diacylglycerol--glycerol-3-phosphate
3-phosphatidyltransferase"
/protein_id="AQW33797.1"
gene complement(1026289..1027146)
/locus_tag="B1761_05575"
CDS complement(1026289..1027146)
/locus_tag="B1761_05575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947779.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33798.1"
gene complement(1027205..1028482)
/locus_tag="B1761_05580"
CDS complement(1027205..1028482)
/locus_tag="B1761_05580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227625.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase M16"
/protein_id="AQW33799.1"
gene complement(1028484..1029734)
/locus_tag="B1761_05585"
CDS complement(1028484..1029734)
/locus_tag="B1761_05585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014635200.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase M16"
/protein_id="AQW33800.1"
gene 1029812..1030189
/locus_tag="B1761_05590"
CDS 1029812..1030189
/locus_tag="B1761_05590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947785.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33801.1"
gene 1030192..1031292
/locus_tag="B1761_05595"
CDS 1030192..1031292
/locus_tag="B1761_05595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014635202.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA replication and repair protein RecF"
/protein_id="AQW33802.1"
gene complement(1031461..1032942)
/locus_tag="B1761_05600"
CDS complement(1031461..1032942)
/locus_tag="B1761_05600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003085743.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IMP dehydrogenase"
/protein_id="AQW33803.1"
gene complement(1033119..1034141)
/locus_tag="B1761_05605"
CDS complement(1033119..1034141)
/locus_tag="B1761_05605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003045853.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tryptophan--tRNA ligase"
/protein_id="AQW33804.1"
gene 1034569..1035441
/locus_tag="B1761_05610"
CDS 1034569..1035441
/locus_tag="B1761_05610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013991342.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33805.1"
gene 1035508..1037130
/locus_tag="B1761_05615"
CDS 1035508..1037130
/locus_tag="B1761_05615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014635203.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC-F family ATPase"
/protein_id="AQW33806.1"
gene 1037180..1039786
/locus_tag="B1761_05620"
CDS 1037180..1039786
/locus_tag="B1761_05620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946816.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW33807.1"
gene complement(1039875..1039948)
/locus_tag="B1761_05625"
tRNA complement(1039875..1039948)
/locus_tag="B1761_05625"
/product="tRNA-Asn"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(1039912..1039914),aa:Asn,
seq:gtt)
gene complement(1039971..1040042)
/locus_tag="B1761_05630"
tRNA complement(1039971..1040042)
/locus_tag="B1761_05630"
/product="tRNA-Glu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:complement(1040007..1040009),aa:Glu,
seq:ttc)
gene 1040230..1040303
/locus_tag="B1761_05635"
tRNA 1040230..1040303
/locus_tag="B1761_05635"
/product="tRNA-Arg"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1040264..1040266,aa:Arg,seq:tct)
gene complement(1040329..1041012)
/locus_tag="B1761_05640"
CDS complement(1040329..1041012)
/locus_tag="B1761_05640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226711.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF1275 family protein"
/protein_id="AQW33808.1"
gene complement(1041028..1041507)
/locus_tag="B1761_05645"
CDS complement(1041028..1041507)
/locus_tag="B1761_05645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018164718.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="23S rRNA
(pseudouridine(1915)-N(3))-methyltransferase RlmH"
/protein_id="AQW33809.1"
gene 1041712..1042947
/locus_tag="B1761_05650"
CDS 1041712..1042947
/locus_tag="B1761_05650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952298.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine protease"
/protein_id="AQW33810.1"
gene 1043013..1043780
/locus_tag="B1761_05655"
CDS 1043013..1043780
/locus_tag="B1761_05655"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095245.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chromosome partitioning protein ParB"
/protein_id="AQW33811.1"
gene 1044020..1045384
/locus_tag="B1761_05660"
CDS 1044020..1045384
/locus_tag="B1761_05660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012657571.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chromosomal replication initiator protein DnaA"
/protein_id="AQW33812.1"
gene 1045539..1046675
/locus_tag="B1761_05665"
CDS 1045539..1046675
/locus_tag="B1761_05665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003107957.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase III subunit beta"
/protein_id="AQW33813.1"
gene 1046726..1046917
/locus_tag="B1761_05670"
CDS 1046726..1046917
/locus_tag="B1761_05670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017769774.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33814.1"
gene 1047130..1048245
/locus_tag="B1761_05675"
CDS 1047130..1048245
/locus_tag="B1761_05675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002269933.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTP-binding protein YchF"
/protein_id="AQW33815.1"
gene 1048318..1048887
/locus_tag="B1761_05680"
CDS 1048318..1048887
/locus_tag="B1761_05680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948591.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidyl-tRNA hydrolase"
/protein_id="AQW33816.1"
gene 1048880..1052386
/locus_tag="B1761_05685"
CDS 1048880..1052386
/locus_tag="B1761_05685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680577.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcription-repair coupling factor"
/protein_id="AQW33817.1"
gene 1052572..1052847
/locus_tag="B1761_05690"
CDS 1052572..1052847
/locus_tag="B1761_05690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883975.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33818.1"
gene 1052831..1053202
/locus_tag="B1761_05695"
CDS 1052831..1053202
/locus_tag="B1761_05695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886276.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="septum formation initiation protein"
/protein_id="AQW33819.1"
gene 1053202..1053333
/locus_tag="B1761_05700"
CDS 1053202..1053333
/locus_tag="B1761_05700"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948953.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="recombinase"
/protein_id="AQW33820.1"
gene 1053330..1054622
/locus_tag="B1761_05705"
CDS 1053330..1054622
/locus_tag="B1761_05705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013989875.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine hydrolase"
/protein_id="AQW33821.1"
gene 1054622..1055887
/locus_tag="B1761_05710"
CDS 1054622..1055887
/locus_tag="B1761_05710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948955.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA(Ile)-lysidine synthase"
/protein_id="AQW33822.1"
gene 1055969..1056511
/locus_tag="B1761_05715"
CDS 1055969..1056511
/locus_tag="B1761_05715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012514693.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypoxanthine-guanine phosphoribosyltransferase"
/protein_id="AQW33823.1"
gene 1056527..1058494
/locus_tag="B1761_05720"
CDS 1056527..1058494
/locus_tag="B1761_05720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225243.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein FtsH"
/protein_id="AQW33824.1"
gene complement(1058671..1059063)
/locus_tag="B1761_05725"
CDS complement(1058671..1059063)
/locus_tag="B1761_05725"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33825.1"
gene complement(1059060..1059829)
/locus_tag="B1761_05730"
/pseudo
CDS complement(1059060..1059829)
/locus_tag="B1761_05730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009754702.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 1059892..1060428
/locus_tag="B1761_05735"
CDS 1059892..1060428
/locus_tag="B1761_05735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002914493.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33826.1"
gene 1060404..1060742
/locus_tag="B1761_05740"
CDS 1060404..1060742
/locus_tag="B1761_05740"
/inference="COORDINATES: protein motif:HMM:PF13276.4"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33827.1"
gene 1060756..1061244
/locus_tag="B1761_05745"
CDS 1060756..1061244
/locus_tag="B1761_05745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680582.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33828.1"
gene 1061646..1063200
/locus_tag="B1761_05750"
rRNA 1061646..1063200
/locus_tag="B1761_05750"
/product="16S ribosomal RNA"
gene 1063247..1063319
/locus_tag="B1761_05755"
tRNA 1063247..1063319
/locus_tag="B1761_05755"
/product="tRNA-Ala"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1063280..1063282,aa:Ala,seq:tgc)
gene 1063465..1066366
/locus_tag="B1761_05760"
rRNA 1063465..1066366
/locus_tag="B1761_05760"
/product="23S ribosomal RNA"
gene 1066449..1066564
/gene="rrf"
/locus_tag="B1761_05765"
rRNA 1066449..1066564
/gene="rrf"
/locus_tag="B1761_05765"
/product="5S ribosomal RNA"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00001"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00001"
gene 1066570..1066642
/locus_tag="B1761_05770"
tRNA 1066570..1066642
/locus_tag="B1761_05770"
/product="tRNA-Val"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1066603..1066605,aa:Val,seq:tac)
gene 1066645..1066717
/locus_tag="B1761_05775"
tRNA 1066645..1066717
/locus_tag="B1761_05775"
/product="tRNA-Asp"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1066678..1066680,aa:Asp,seq:gtc)
gene 1066737..1066809
/locus_tag="B1761_05780"
tRNA 1066737..1066809
/locus_tag="B1761_05780"
/product="tRNA-Lys"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1066770..1066772,aa:Lys,seq:ttt)
gene 1066815..1066896
/locus_tag="B1761_05785"
tRNA 1066815..1066896
/locus_tag="B1761_05785"
/product="tRNA-Leu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1066849..1066851,aa:Leu,seq:tag)
gene 1066911..1066983
/locus_tag="B1761_05790"
tRNA 1066911..1066983
/locus_tag="B1761_05790"
/product="tRNA-Thr"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1066944..1066946,aa:Thr,seq:tgt)
gene 1066990..1067061
/locus_tag="B1761_05795"
tRNA 1066990..1067061
/locus_tag="B1761_05795"
/product="tRNA-Gly"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067022..1067024,aa:Gly,seq:gcc)
gene 1067068..1067153
/locus_tag="B1761_05800"
tRNA 1067068..1067153
/locus_tag="B1761_05800"
/product="tRNA-Leu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067102..1067104,aa:Leu,seq:taa)
gene 1067168..1067241
/locus_tag="B1761_05805"
tRNA 1067168..1067241
/locus_tag="B1761_05805"
/product="tRNA-Arg"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067202..1067204,aa:Arg,seq:acg)
gene 1067249..1067322
/locus_tag="B1761_05810"
tRNA 1067249..1067322
/locus_tag="B1761_05810"
/product="tRNA-Pro"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067283..1067285,aa:Pro,seq:tgg)
gene 1067328..1067401
/locus_tag="B1761_05815"
tRNA 1067328..1067401
/locus_tag="B1761_05815"
/product="tRNA-Met"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067362..1067364,aa:Met,seq:cat)
gene 1067416..1067489
/locus_tag="B1761_05820"
tRNA 1067416..1067489
/locus_tag="B1761_05820"
/product="tRNA-Met"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067450..1067452,aa:Met,seq:cat)
gene 1067509..1067598
/locus_tag="B1761_05825"
tRNA 1067509..1067598
/locus_tag="B1761_05825"
/product="tRNA-Ser"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067545..1067547,aa:Ser,seq:tga)
gene 1067608..1067681
/locus_tag="B1761_05830"
tRNA 1067608..1067681
/locus_tag="B1761_05830"
/product="tRNA-Met"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067642..1067644,aa:Met,seq:cat)
gene 1067685..1067757
/locus_tag="B1761_05835"
tRNA 1067685..1067757
/locus_tag="B1761_05835"
/product="tRNA-Phe"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067718..1067720,aa:Phe,seq:gaa)
gene 1067770..1067840
/locus_tag="B1761_05840"
tRNA 1067770..1067840
/locus_tag="B1761_05840"
/product="tRNA-Gly"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067802..1067804,aa:Gly,seq:tcc)
gene 1067874..1067947
/locus_tag="B1761_05845"
tRNA 1067874..1067947
/locus_tag="B1761_05845"
/product="tRNA-Ile"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067908..1067910,aa:Ile,seq:gat)
gene 1067952..1068039
/locus_tag="B1761_05850"
tRNA 1067952..1068039
/locus_tag="B1761_05850"
/product="tRNA-Ser"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1067986..1067988,aa:Ser,seq:gct)
gene 1068096..1068926
/locus_tag="B1761_05855"
CDS 1068096..1068926
/locus_tag="B1761_05855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948142.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="rod shape-determining protein MreC"
/protein_id="AQW33829.1"
gene 1068928..1069452
/locus_tag="B1761_05860"
CDS 1068928..1069452
/locus_tag="B1761_05860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948139.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="rod shape-determining protein MreD"
/protein_id="AQW33830.1"
gene 1069537..1071018
/locus_tag="B1761_05865"
CDS 1069537..1071018
/locus_tag="B1761_05865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948136.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CHAP domain-containing protein"
/protein_id="AQW33831.1"
gene 1071232..1072197
/locus_tag="B1761_05870"
CDS 1071232..1072197
/locus_tag="B1761_05870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680585.1"
/note="catalyzes the formation of 5-phospho-alpha-D-ribose
1-phosphate from D-ribose 5-phosphate and ATP; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribose-phosphate pyrophosphokinase"
/protein_id="AQW33832.1"
gene complement(1072239..1072853)
/locus_tag="B1761_05875"
/pseudo
CDS complement(1072239..1072853)
/locus_tag="B1761_05875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002296233.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 1073304..1074479
/locus_tag="B1761_05880"
CDS 1073304..1074479
/locus_tag="B1761_05880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004181974.1"
/note="catalyzes the transamination of the aromatic amino
acid forming a ketoacid; first step in aromatic amino acid
degradation in lactococci; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="aromatic amino acid aminotransferase"
/protein_id="AQW33833.1"
gene 1074466..1075239
/locus_tag="B1761_05885"
CDS 1074466..1075239
/locus_tag="B1761_05885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680587.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA repair protein RecO"
/protein_id="AQW33834.1"
gene 1075455..1076459
/locus_tag="B1761_05890"
CDS 1075455..1076459
/locus_tag="B1761_05890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680588.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphate acyltransferase"
/protein_id="AQW33835.1"
gene 1076459..1076704
/locus_tag="B1761_05895"
CDS 1076459..1076704
/locus_tag="B1761_05895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949008.1"
/note="carries the fatty acid chain in fatty acid
biosynthesis; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acyl carrier protein"
/protein_id="AQW33836.1"
gene 1076990..1077697
/locus_tag="B1761_05900"
CDS 1076990..1077697
/locus_tag="B1761_05900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889566.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosylaminoimidazolesuccinocarboxamide
synthase"
/protein_id="AQW33837.1"
gene 1077753..1081478
/locus_tag="B1761_05905"
CDS 1077753..1081478
/locus_tag="B1761_05905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000361233.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosylformylglycinamidine synthase"
/protein_id="AQW33838.1"
gene 1081647..1083086
/locus_tag="B1761_05910"
CDS 1081647..1083086
/locus_tag="B1761_05910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000220662.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amidophosphoribosyltransferase"
/protein_id="AQW33839.1"
gene 1083117..1084136
/locus_tag="B1761_05915"
CDS 1083117..1084136
/locus_tag="B1761_05915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003009290.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosylformylglycinamidine cyclo-ligase"
/protein_id="AQW33840.1"
gene 1084136..1084690
/locus_tag="B1761_05920"
CDS 1084136..1084690
/locus_tag="B1761_05920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016466423.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosylglycinamide formyltransferase"
/protein_id="AQW33841.1"
gene 1084759..1086306
/locus_tag="B1761_05925"
CDS 1084759..1086306
/locus_tag="B1761_05925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006146083.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional
phosphoribosylaminoimidazolecarboxamide
formyltransferase/inosine monophosphate cyclohydrolase"
/protein_id="AQW33842.1"
gene 1086477..1086935
/locus_tag="B1761_05930"
CDS 1086477..1086935
/locus_tag="B1761_05930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006596912.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW33843.1"
gene 1086989..1087597
/locus_tag="B1761_05935"
/pseudo
CDS 1086989..1087597
/locus_tag="B1761_05935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883949.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="integrase"
gene complement(1087702..1088541)
/locus_tag="B1761_05940"
CDS complement(1087702..1088541)
/locus_tag="B1761_05940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680595.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CHAP domain-containing protein"
/protein_id="AQW33844.1"
gene 1088850..1090112
/locus_tag="B1761_05945"
CDS 1088850..1090112
/locus_tag="B1761_05945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226734.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosylamine--glycine ligase"
/protein_id="AQW33845.1"
gene 1090458..1090946
/locus_tag="B1761_05950"
CDS 1090458..1090946
/locus_tag="B1761_05950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006595294.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="5-(carboxyamino)imidazole ribonucleotide mutase"
/protein_id="AQW33846.1"
gene 1090933..1092024
/locus_tag="B1761_05955"
CDS 1090933..1092024
/locus_tag="B1761_05955"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000099033.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="5-(carboxyamino)imidazole ribonucleotide
synthase"
/protein_id="AQW33847.1"
gene 1092217..1092972
/locus_tag="B1761_05960"
CDS 1092217..1092972
/locus_tag="B1761_05960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225272.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2-dehydropantoate 2-reductase"
/protein_id="AQW33848.1"
gene 1093044..1093208
/locus_tag="B1761_05965"
CDS 1093044..1093208
/locus_tag="B1761_05965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226738.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoribosylaminoimidazole carboxylase"
/protein_id="AQW33849.1"
gene 1093487..1094785
/locus_tag="B1761_05970"
CDS 1093487..1094785
/locus_tag="B1761_05970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000572899.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="adenylosuccinate lyase"
/protein_id="AQW33850.1"
gene complement(1095649..1097340)
/locus_tag="B1761_05975"
CDS complement(1095649..1097340)
/locus_tag="B1761_05975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018164778.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="arginine--tRNA ligase"
/protein_id="AQW33851.1"
gene complement(1097373..1097763)
/locus_tag="B1761_05980"
/pseudo
CDS complement(1097373..1097763)
/locus_tag="B1761_05980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093245.1"
/note="frameshifted; incomplete; partial on complete
genome; missing start; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1098165..1099352
/locus_tag="B1761_05985"
CDS 1098165..1099352
/locus_tag="B1761_05985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002334574.1"
/note="catalyzes the formation of UDP-glucuronate from
UDP-glucose; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-glucose 6-dehydrogenase"
/protein_id="AQW33852.1"
gene 1099437..1100630
/locus_tag="B1761_05990"
CDS 1099437..1100630
/locus_tag="B1761_05990"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002355375.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase"
/protein_id="AQW33853.1"
gene 1101128..1101613
/locus_tag="B1761_05995"
CDS 1101128..1101613
/locus_tag="B1761_05995"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607832.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NUDIX hydrolase"
/protein_id="AQW33854.1"
gene 1101617..1101808
/locus_tag="B1761_06000"
CDS 1101617..1101808
/locus_tag="B1761_06000"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681104.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33855.1"
gene 1101986..1102435
/locus_tag="B1761_06005"
CDS 1101986..1102435
/locus_tag="B1761_06005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681031.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34540.1"
gene 1102698..1102891
/locus_tag="B1761_06010"
/pseudo
CDS 1102698..1102891
/locus_tag="B1761_06010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002988813.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1103003..1103773
/locus_tag="B1761_06015"
CDS 1103003..1103773
/locus_tag="B1761_06015"
/inference="COORDINATES: protein motif:HMM:PF02452.15"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33856.1"
gene 1104520..1104945
/locus_tag="B1761_06020"
CDS 1104520..1104945
/locus_tag="B1761_06020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633772.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="arginine repressor"
/protein_id="AQW33857.1"
gene 1104945..1105304
/locus_tag="B1761_06025"
CDS 1104945..1105304
/locus_tag="B1761_06025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225277.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33858.1"
gene 1105297..1107855
/locus_tag="B1761_06030"
CDS 1105297..1107855
/locus_tag="B1761_06030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949048.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA mismatch repair protein MutS"
/protein_id="AQW33859.1"
gene complement(1107889..1108344)
/locus_tag="B1761_06035"
/pseudo
CDS complement(1107889..1108344)
/locus_tag="B1761_06035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098284.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(1108341..1108777)
/locus_tag="B1761_06040"
/pseudo
CDS complement(1108341..1108777)
/locus_tag="B1761_06040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633775.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
gene 1108956..1109261
/locus_tag="B1761_06045"
CDS 1108956..1109261
/locus_tag="B1761_06045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949050.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33860.1"
gene 1109313..1111256
/locus_tag="B1761_06050"
CDS 1109313..1111256
/locus_tag="B1761_06050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888580.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA mismatch repair protein MutL"
/protein_id="AQW33861.1"
gene 1111386..1111607
/locus_tag="B1761_06055"
CDS 1111386..1111607
/locus_tag="B1761_06055"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680602.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33862.1"
gene 1111759..1112349
/locus_tag="B1761_06060"
CDS 1111759..1112349
/locus_tag="B1761_06060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015912071.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Holliday junction branch migration protein RuvA"
/protein_id="AQW33863.1"
gene 1112356..1112910
/locus_tag="B1761_06065"
CDS 1112356..1112910
/locus_tag="B1761_06065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888575.1"
/note="constitutive, catalyzes the hydrolysis of alkylated
DNA, releasing 3-methyladenine; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="3-methyladenine DNA glycosylase"
/protein_id="AQW33864.1"
gene 1113006..1114277
/locus_tag="B1761_06070"
CDS 1113006..1114277
/locus_tag="B1761_06070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225285.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence/damage-inducible protein A"
/protein_id="AQW33865.1"
gene 1114313..1115467
/locus_tag="B1761_06075"
CDS 1114313..1115467
/locus_tag="B1761_06075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003066896.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA recombination/repair protein RecA"
/protein_id="AQW33866.1"
gene 1115644..1116042
/locus_tag="B1761_06080"
CDS 1115644..1116042
/locus_tag="B1761_06080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017768833.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator Spx"
/protein_id="AQW33867.1"
gene 1116458..1118012
/locus_tag="B1761_06085"
rRNA 1116458..1118012
/locus_tag="B1761_06085"
/product="16S ribosomal RNA"
gene 1118059..1118131
/locus_tag="B1761_06090"
tRNA 1118059..1118131
/locus_tag="B1761_06090"
/product="tRNA-Ala"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1118092..1118094,aa:Ala,seq:tgc)
gene 1118277..1121178
/locus_tag="B1761_06095"
rRNA 1118277..1121178
/locus_tag="B1761_06095"
/product="23S ribosomal RNA"
gene 1121261..1121376
/gene="rrf"
/locus_tag="B1761_06100"
rRNA 1121261..1121376
/gene="rrf"
/locus_tag="B1761_06100"
/product="5S ribosomal RNA"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00001"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00001"
gene 1121382..1121454
/locus_tag="B1761_06105"
tRNA 1121382..1121454
/locus_tag="B1761_06105"
/product="tRNA-Val"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1121415..1121417,aa:Val,seq:tac)
gene 1121459..1121529
/locus_tag="B1761_06110"
tRNA 1121459..1121529
/locus_tag="B1761_06110"
/product="tRNA-Gly"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1121491..1121493,aa:Gly,seq:tcc)
gene 1121563..1121636
/locus_tag="B1761_06115"
tRNA 1121563..1121636
/locus_tag="B1761_06115"
/product="tRNA-Ile"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1121597..1121599,aa:Ile,seq:gat)
gene 1121643..1121714
/locus_tag="B1761_06120"
tRNA 1121643..1121714
/locus_tag="B1761_06120"
/product="tRNA-Glu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1121676..1121678,aa:Glu,seq:ttc)
gene 1121723..1121812
/locus_tag="B1761_06125"
tRNA 1121723..1121812
/locus_tag="B1761_06125"
/product="tRNA-Ser"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1121759..1121761,aa:Ser,seq:tga)
gene 1121822..1121895
/locus_tag="B1761_06130"
tRNA 1121822..1121895
/locus_tag="B1761_06130"
/product="tRNA-Met"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1121856..1121858,aa:Met,seq:cat)
gene 1121899..1121971
/locus_tag="B1761_06135"
tRNA 1121899..1121971
/locus_tag="B1761_06135"
/product="tRNA-Phe"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1121932..1121934,aa:Phe,seq:gaa)
gene 1121986..1122066
/locus_tag="B1761_06140"
tRNA 1121986..1122066
/locus_tag="B1761_06140"
/product="tRNA-Tyr"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1122020..1122022,aa:Tyr,seq:gta)
gene 1122072..1122142
/locus_tag="B1761_06145"
tRNA 1122072..1122142
/locus_tag="B1761_06145"
/product="tRNA-Trp"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1122104..1122106,aa:Trp,seq:cca)
gene 1122154..1122226
/locus_tag="B1761_06150"
tRNA 1122154..1122226
/locus_tag="B1761_06150"
/product="tRNA-His"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1122187..1122189,aa:His,seq:gtg)
gene 1122233..1122304
/locus_tag="B1761_06155"
tRNA 1122233..1122304
/locus_tag="B1761_06155"
/product="tRNA-Gln"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1122265..1122267,aa:Gln,seq:ttg)
gene 1122314..1122397
/locus_tag="B1761_06160"
tRNA 1122314..1122397
/locus_tag="B1761_06160"
/product="tRNA-Leu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1122348..1122350,aa:Leu,seq:caa)
gene 1122448..1126842
/gene="polC"
/locus_tag="B1761_06165"
CDS 1122448..1126842
/gene="polC"
/locus_tag="B1761_06165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008536216.1"
/note="catalyzes DNA-template-directed extension of the
3'- end of a DNA strand by one nucleotide at a time;
required for leading strand synthesis; PolC exhibits 3' to
5' exonuclease activity; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase III subunit alpha"
/protein_id="AQW33868.1"
gene 1127006..1128247
/locus_tag="B1761_06170"
CDS 1127006..1128247
/locus_tag="B1761_06170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098303.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminopeptidase"
/protein_id="AQW33869.1"
gene 1128267..1128497
/locus_tag="B1761_06175"
CDS 1128267..1128497
/locus_tag="B1761_06175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888342.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33870.1"
gene 1128667..1129059
/locus_tag="B1761_06180"
/pseudo
CDS 1128667..1129059
/locus_tag="B1761_06180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000526288.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="MarR family transcriptional regulator"
gene 1129148..1129699
/locus_tag="B1761_06185"
CDS 1129148..1129699
/locus_tag="B1761_06185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607843.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NAD(P)H-dependent oxidoreductase"
/protein_id="AQW33871.1"
gene complement(1129749..1130285)
/locus_tag="B1761_06190"
/pseudo
CDS complement(1129749..1130285)
/locus_tag="B1761_06190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003007166.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(1130412..1130633)
/locus_tag="B1761_06195"
CDS complement(1130412..1130633)
/locus_tag="B1761_06195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225293.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33872.1"
gene complement(1130900..1131826)
/locus_tag="B1761_06200"
/pseudo
CDS complement(1130900..1131826)
/locus_tag="B1761_06200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002899578.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="LD-carboxypeptidase"
gene 1131993..1132063
/locus_tag="B1761_06205"
tRNA 1131993..1132063
/locus_tag="B1761_06205"
/product="tRNA-Cys"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1132025..1132027,aa:Cys,seq:gca)
gene 1132378..1133145
/locus_tag="B1761_06210"
CDS 1132378..1133145
/locus_tag="B1761_06210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680612.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S2"
/protein_id="AQW33873.1"
gene 1133256..1134296
/locus_tag="B1761_06215"
CDS 1133256..1134296
/locus_tag="B1761_06215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003053075.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="elongation factor Ts"
/protein_id="AQW33874.1"
gene complement(1134406..1134876)
/locus_tag="B1761_06220"
CDS complement(1134406..1134876)
/locus_tag="B1761_06220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018363707.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="small multidrug export protein"
/protein_id="AQW33875.1"
gene 1135120..1135575
/locus_tag="B1761_06225"
CDS 1135120..1135575
/locus_tag="B1761_06225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949111.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CtsR family transcriptional regulator"
/protein_id="AQW33876.1"
gene 1135576..1138026
/locus_tag="B1761_06230"
CDS 1135576..1138026
/locus_tag="B1761_06230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949119.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chaperone protein ClpB"
/protein_id="AQW33877.1"
gene complement(1138154..1138972)
/locus_tag="B1761_06235"
CDS complement(1138154..1138972)
/locus_tag="B1761_06235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008536229.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanyl-D-alanine carboxypeptidase"
/protein_id="AQW33878.1"
gene complement(1138992..1139453)
/locus_tag="B1761_06240"
/pseudo
CDS complement(1138992..1139453)
/locus_tag="B1761_06240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621033.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptidase M15"
gene complement(1139556..1140803)
/locus_tag="B1761_06245"
CDS complement(1139556..1140803)
/locus_tag="B1761_06245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948441.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanyl-D-alanine carboxypeptidase"
/protein_id="AQW33879.1"
gene 1141012..1143237
/locus_tag="B1761_06250"
CDS 1141012..1143237
/locus_tag="B1761_06250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948442.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="polyribonucleotide nucleotidyltransferase"
/protein_id="AQW33880.1"
gene 1143246..1144016
/locus_tag="B1761_06255"
CDS 1143246..1144016
/locus_tag="B1761_06255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621036.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33881.1"
gene 1144089..1144709
/locus_tag="B1761_06260"
CDS 1144089..1144709
/locus_tag="B1761_06260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018364592.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine O-acetyltransferase"
/protein_id="AQW33882.1"
gene 1145091..1146434
/locus_tag="B1761_06265"
CDS 1145091..1146434
/locus_tag="B1761_06265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888303.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cysteine--tRNA ligase"
/protein_id="AQW33883.1"
gene 1146427..1146828
/locus_tag="B1761_06270"
CDS 1146427..1146828
/locus_tag="B1761_06270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680620.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Mini-ribonuclease 3"
/protein_id="AQW33884.1"
gene 1147342..1147530
/locus_tag="B1761_06275"
CDS 1147342..1147530
/locus_tag="B1761_06275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948459.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33885.1"
gene 1147601..1147843
/locus_tag="B1761_06280"
CDS 1147601..1147843
/locus_tag="B1761_06280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680622.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33886.1"
gene 1147891..1148634
/locus_tag="B1761_06285"
CDS 1147891..1148634
/locus_tag="B1761_06285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225307.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="23S rRNA
(guanosine(2251)-2'-O)-methyltransferase RlmB"
/protein_id="AQW33887.1"
gene 1148637..1149152
/locus_tag="B1761_06290"
CDS 1148637..1149152
/locus_tag="B1761_06290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607853.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
/protein_id="AQW33888.1"
gene 1149161..1150021
/locus_tag="B1761_06295"
CDS 1149161..1150021
/locus_tag="B1761_06295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949140.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="fatty acid-binding protein DegV"
/protein_id="AQW33889.1"
gene 1150199..1150291
/locus_tag="B1761_06300"
CDS 1150199..1150291
/locus_tag="B1761_06300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949141.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33890.1"
gene 1150322..1150822
/locus_tag="B1761_06305"
CDS 1150322..1150822
/locus_tag="B1761_06305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680625.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33891.1"
gene 1150970..1151926
/locus_tag="B1761_06310"
CDS 1150970..1151926
/locus_tag="B1761_06310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948468.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2-dehydropantoate 2-reductase"
/protein_id="AQW33892.1"
gene 1152135..1152581
/locus_tag="B1761_06315"
CDS 1152135..1152581
/locus_tag="B1761_06315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003083327.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L13"
/protein_id="AQW33893.1"
gene 1152609..1153001
/locus_tag="B1761_06320"
CDS 1152609..1153001
/locus_tag="B1761_06320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002942223.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S9"
/protein_id="AQW33894.1"
gene complement(1153112..1153446)
/locus_tag="B1761_06325"
/pseudo
CDS complement(1153112..1153446)
/locus_tag="B1761_06325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016502668.1"
/note="frameshifted; incomplete; partial on complete
genome; missing start; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="site-specific integrase"
gene 1153476..1153739
/locus_tag="B1761_06330"
CDS 1153476..1153739
/locus_tag="B1761_06330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947799.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33895.1"
gene 1153989..1154093
/locus_tag="B1761_06335"
CDS 1153989..1154093
/locus_tag="B1761_06335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225312.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin"
/protein_id="AQW33896.1"
gene 1154155..1157064
/locus_tag="B1761_06340"
/pseudo
CDS 1154155..1157064
/locus_tag="B1761_06340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000472732.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="lantibiotic biosynthesis protein"
gene 1157102..1158325
/locus_tag="B1761_06345"
CDS 1157102..1158325
/locus_tag="B1761_06345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225314.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lantibiotic biosynthesis protein"
/protein_id="AQW33897.1"
gene 1158349..1159613
/locus_tag="B1761_06350"
/pseudo
CDS 1158349..1159613
/locus_tag="B1761_06350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607858.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="lantibiotic transporter"
gene 1159629..1160353
/locus_tag="B1761_06355"
/pseudo
CDS 1159629..1160353
/locus_tag="B1761_06355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002942230.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="cell filamentation protein Fic"
gene complement(1160690..1161907)
/locus_tag="B1761_06360"
CDS complement(1160690..1161907)
/locus_tag="B1761_06360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607860.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="site-specific integrase"
/protein_id="AQW33898.1"
gene complement(1161918..1162190)
/locus_tag="B1761_06365"
CDS complement(1161918..1162190)
/locus_tag="B1761_06365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003103297.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
/protein_id="AQW33899.1"
gene complement(1162252..1163442)
/locus_tag="B1761_06370"
CDS complement(1162252..1163442)
/locus_tag="B1761_06370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727294.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33900.1"
gene complement(1163689..1164399)
/locus_tag="B1761_06375"
/pseudo
CDS complement(1163689..1164399)
/locus_tag="B1761_06375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006595215.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="CHAP domain-containing protein"
gene complement(1164454..1165135)
/locus_tag="B1761_06380"
/pseudo
CDS complement(1164454..1165135)
/locus_tag="B1761_06380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002339851.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS6 family transposase"
gene 1165291..1166508
/locus_tag="B1761_06385"
CDS 1165291..1166508
/locus_tag="B1761_06385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633796.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="metallophosphatase"
/protein_id="AQW33901.1"
gene 1166829..1167095
/locus_tag="B1761_06390"
CDS 1166829..1167095
/locus_tag="B1761_06390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092287.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33902.1"
gene 1167113..1168450
/locus_tag="B1761_06395"
CDS 1167113..1168450
/locus_tag="B1761_06395"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018166727.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PFL family protein"
/protein_id="AQW33903.1"
gene 1168568..1168947
/locus_tag="B1761_06400"
/pseudo
CDS 1168568..1168947
/locus_tag="B1761_06400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888270.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1168934..1169731
/locus_tag="B1761_06405"
CDS 1168934..1169731
/locus_tag="B1761_06405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098361.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanyl-D-alanine carboxypeptidase"
/protein_id="AQW33904.1"
gene 1169728..1170312
/locus_tag="B1761_06410"
CDS 1169728..1170312
/locus_tag="B1761_06410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949166.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidoglycan hydrolase"
/protein_id="AQW33905.1"
gene 1170502..1171584
/locus_tag="B1761_06415"
CDS 1170502..1171584
/locus_tag="B1761_06415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225328.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HrcA family transcriptional regulator"
/protein_id="AQW33906.1"
gene 1171577..1172191
/locus_tag="B1761_06420"
CDS 1171577..1172191
/locus_tag="B1761_06420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680648.1"
/note="with DnaK and DnaJ acts in response to hyperosmotic
and heat shock by preventing the aggregation of
stress-denatured proteins; may act as a thermosensor;
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nucleotide exchange factor GrpE"
/protein_id="AQW33907.1"
gene 1172320..1174143
/locus_tag="B1761_06425"
CDS 1172320..1174143
/locus_tag="B1761_06425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946936.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="molecular chaperone DnaK"
/protein_id="AQW33908.1"
gene 1174571..1175704
/locus_tag="B1761_06430"
CDS 1174571..1175704
/locus_tag="B1761_06430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886399.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="molecular chaperone DnaJ"
/protein_id="AQW33909.1"
gene 1175810..1176556
/locus_tag="B1761_06435"
CDS 1175810..1176556
/locus_tag="B1761_06435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946941.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA pseudouridine(38-40) synthase TruA"
/protein_id="AQW33910.1"
gene 1176549..1177310
/locus_tag="B1761_06440"
CDS 1176549..1177310
/locus_tag="B1761_06440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949177.1"
/note="catalyzes the formation of
4-amino-2-methyl-5-diphosphomethylpyrimidine; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hydroxymethylpyrimidine/phosphomethylpyrimidine
kinase"
/protein_id="AQW33911.1"
gene 1177323..1177769
/locus_tag="B1761_06445"
CDS 1177323..1177769
/locus_tag="B1761_06445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887341.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ECF transporter S component"
/protein_id="AQW33912.1"
gene 1178155..1179709
/locus_tag="B1761_06450"
rRNA 1178155..1179709
/locus_tag="B1761_06450"
/product="16S ribosomal RNA"
gene 1179756..1179828
/locus_tag="B1761_06455"
tRNA 1179756..1179828
/locus_tag="B1761_06455"
/product="tRNA-Ala"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1179789..1179791,aa:Ala,seq:tgc)
gene 1179974..1182875
/locus_tag="B1761_06460"
rRNA 1179974..1182875
/locus_tag="B1761_06460"
/product="23S ribosomal RNA"
gene 1182958..1183073
/gene="rrf"
/locus_tag="B1761_06465"
rRNA 1182958..1183073
/gene="rrf"
/locus_tag="B1761_06465"
/product="5S ribosomal RNA"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00001"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00001"
gene 1183079..1183151
/locus_tag="B1761_06470"
tRNA 1183079..1183151
/locus_tag="B1761_06470"
/product="tRNA-Val"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183112..1183114,aa:Val,seq:tac)
gene 1183154..1183226
/locus_tag="B1761_06475"
tRNA 1183154..1183226
/locus_tag="B1761_06475"
/product="tRNA-Asp"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183187..1183189,aa:Asp,seq:gtc)
gene 1183246..1183318
/locus_tag="B1761_06480"
tRNA 1183246..1183318
/locus_tag="B1761_06480"
/product="tRNA-Lys"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183279..1183281,aa:Lys,seq:ttt)
gene 1183324..1183405
/locus_tag="B1761_06485"
tRNA 1183324..1183405
/locus_tag="B1761_06485"
/product="tRNA-Leu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183358..1183360,aa:Leu,seq:tag)
gene 1183420..1183492
/locus_tag="B1761_06490"
tRNA 1183420..1183492
/locus_tag="B1761_06490"
/product="tRNA-Thr"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183453..1183455,aa:Thr,seq:tgt)
gene 1183499..1183570
/locus_tag="B1761_06495"
tRNA 1183499..1183570
/locus_tag="B1761_06495"
/product="tRNA-Gly"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183531..1183533,aa:Gly,seq:gcc)
gene 1183577..1183662
/locus_tag="B1761_06500"
tRNA 1183577..1183662
/locus_tag="B1761_06500"
/product="tRNA-Leu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183611..1183613,aa:Leu,seq:taa)
gene 1183677..1183750
/locus_tag="B1761_06505"
tRNA 1183677..1183750
/locus_tag="B1761_06505"
/product="tRNA-Arg"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183711..1183713,aa:Arg,seq:acg)
gene 1183758..1183831
/locus_tag="B1761_06510"
tRNA 1183758..1183831
/locus_tag="B1761_06510"
/product="tRNA-Pro"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1183792..1183794,aa:Pro,seq:tgg)
gene 1183961..1185515
/locus_tag="B1761_06515"
rRNA 1183961..1185515
/locus_tag="B1761_06515"
/product="16S ribosomal RNA"
gene 1185562..1185634
/locus_tag="B1761_06520"
tRNA 1185562..1185634
/locus_tag="B1761_06520"
/product="tRNA-Ala"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1185595..1185597,aa:Ala,seq:tgc)
gene 1185780..1188681
/locus_tag="B1761_06525"
rRNA 1185780..1188681
/locus_tag="B1761_06525"
/product="23S ribosomal RNA"
gene 1188764..1188879
/gene="rrf"
/locus_tag="B1761_06530"
rRNA 1188764..1188879
/gene="rrf"
/locus_tag="B1761_06530"
/product="5S ribosomal RNA"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00001"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00001"
gene 1188885..1188958
/locus_tag="B1761_06535"
tRNA 1188885..1188958
/locus_tag="B1761_06535"
/product="tRNA-Asn"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1188919..1188921,aa:Asn,seq:gtt)
gene 1189712..1191679
/locus_tag="B1761_06540"
CDS 1189712..1191679
/locus_tag="B1761_06540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607872.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
/protein_id="AQW33913.1"
gene complement(1191717..1192628)
/locus_tag="B1761_06545"
CDS complement(1191717..1192628)
/locus_tag="B1761_06545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225334.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
/protein_id="AQW33914.1"
gene 1192831..1193052
/locus_tag="B1761_06550"
CDS 1192831..1193052
/locus_tag="B1761_06550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990711.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF4649 domain-containing protein"
/protein_id="AQW33915.1"
gene 1193103..1193282
/locus_tag="B1761_06555"
CDS 1193103..1193282
/locus_tag="B1761_06555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948996.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33916.1"
gene 1193648..1193974
/locus_tag="B1761_06560"
CDS 1193648..1193974
/locus_tag="B1761_06560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607875.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminoacylase"
/protein_id="AQW33917.1"
gene 1194056..1195246
/locus_tag="B1761_06565"
CDS 1194056..1195246
/locus_tag="B1761_06565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680651.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SAM-dependent methyltransferase"
/protein_id="AQW33918.1"
gene complement(1195500..1195970)
/locus_tag="B1761_06570"
/pseudo
CDS complement(1195500..1195970)
/locus_tag="B1761_06570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621432.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 1196328..1196441
/locus_tag="B1761_06575"
/pseudo
CDS 1196328..1196441
/locus_tag="B1761_06575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534998.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS200/IS605 family transposase"
gene 1196724..1197221
/locus_tag="B1761_06580"
CDS 1196724..1197221
/locus_tag="B1761_06580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949220.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA polymerase subunit sigma-70"
/protein_id="AQW33919.1"
gene complement(1197321..1198163)
/locus_tag="B1761_06585"
CDS complement(1197321..1198163)
/locus_tag="B1761_06585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226789.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="mechanosensitive ion channel protein"
/protein_id="AQW33920.1"
gene 1198304..1199587
/locus_tag="B1761_06590"
CDS 1198304..1199587
/locus_tag="B1761_06590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018380192.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="trigger factor"
/protein_id="AQW33921.1"
gene 1199745..1200320
/locus_tag="B1761_06595"
CDS 1199745..1200320
/locus_tag="B1761_06595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949228.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-directed RNA polymerase subunit delta"
/protein_id="AQW33922.1"
gene 1200571..1202175
/locus_tag="B1761_06600"
CDS 1200571..1202175
/locus_tag="B1761_06600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183889.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CTP synthetase"
/protein_id="AQW33923.1"
gene 1202270..1202740
/locus_tag="B1761_06605"
CDS 1202270..1202740
/locus_tag="B1761_06605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197445.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33924.1"
gene 1202756..1203202
/locus_tag="B1761_06610"
CDS 1202756..1203202
/locus_tag="B1761_06610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197447.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA mismatch repair protein MutT"
/protein_id="AQW33925.1"
gene 1203202..1204155
/locus_tag="B1761_06615"
CDS 1203202..1204155
/locus_tag="B1761_06615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225343.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosomal protein L11 methyltransferase"
/protein_id="AQW33926.1"
gene 1204156..1204899
/locus_tag="B1761_06620"
CDS 1204156..1204899
/locus_tag="B1761_06620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949236.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="16S rRNA (uracil(1498)-N(3))-methyltransferase"
/protein_id="AQW33927.1"
gene 1205153..1205575
/locus_tag="B1761_06625"
CDS 1205153..1205575
/locus_tag="B1761_06625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607881.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="5'-nucleotidase"
/protein_id="AQW33928.1"
gene 1205613..1205780
/locus_tag="B1761_06630"
CDS 1205613..1205780
/locus_tag="B1761_06630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607882.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="diguanylate phosphodiesterase"
/protein_id="AQW33929.1"
gene 1205773..1206525
/locus_tag="B1761_06635"
CDS 1205773..1206525
/locus_tag="B1761_06635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607883.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2',3'-cyclic-nucleotide 2'-phosphodiesterase"
/protein_id="AQW33930.1"
gene 1206432..1207286
/locus_tag="B1761_06640"
CDS 1206432..1207286
/locus_tag="B1761_06640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607884.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cyclo-nucleotide phosphodiesterase"
/protein_id="AQW33931.1"
gene 1207276..1207665
/locus_tag="B1761_06645"
CDS 1207276..1207665
/locus_tag="B1761_06645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225349.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="diguanylate phosphodiesterase"
/protein_id="AQW33932.1"
gene complement(1207652..1208110)
/locus_tag="B1761_06650"
CDS complement(1207652..1208110)
/locus_tag="B1761_06650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680658.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonucleotide reductase assembly protein NrdI"
/protein_id="AQW33933.1"
gene 1208279..1210498
/locus_tag="B1761_06655"
CDS 1208279..1210498
/locus_tag="B1761_06655"
/inference="COORDINATES: similar to AA
sequence:SwissProt:Q54089.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTP pyrophosphokinase"
/protein_id="AQW33934.1"
gene 1210511..1210954
/locus_tag="B1761_06660"
CDS 1210511..1210954
/locus_tag="B1761_06660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018163710.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-aminoacyl-tRNA deacylase"
/protein_id="AQW33935.1"
gene 1211395..1211679
/locus_tag="B1761_06665"
CDS 1211395..1211679
/locus_tag="B1761_06665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621084.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="1,6-alpha-glucanhydrolase"
/protein_id="AQW33936.1"
gene 1211609..1212106
/locus_tag="B1761_06670"
CDS 1211609..1212106
/locus_tag="B1761_06670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197387.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dextranase"
/protein_id="AQW33937.1"
gene 1212161..1212931
/locus_tag="B1761_06675"
CDS 1212161..1212931
/locus_tag="B1761_06675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607888.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="1,6-alpha-glucanhydrolase"
/protein_id="AQW33938.1"
gene 1213232..1214482
/locus_tag="B1761_06680"
CDS 1213232..1214482
/locus_tag="B1761_06680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018365009.1"
/note="catalyzes the formation of 2-oxobutanoate from
L-threonine; biosynthetic; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="threonine dehydratase"
/protein_id="AQW33939.1"
gene complement(1214643..1215257)
/locus_tag="B1761_06685"
CDS complement(1214643..1215257)
/locus_tag="B1761_06685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003063148.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide deformylase"
/protein_id="AQW33940.1"
gene complement(1215358..1215996)
/locus_tag="B1761_06690"
CDS complement(1215358..1215996)
/locus_tag="B1761_06690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095091.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Crp/Fnr family transcriptional regulator"
/protein_id="AQW33941.1"
gene 1216103..1217266
/locus_tag="B1761_06695"
CDS 1216103..1217266
/locus_tag="B1761_06695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680662.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MFS transporter"
/protein_id="AQW33942.1"
gene 1217415..1217684
/locus_tag="B1761_06700"
CDS 1217415..1217684
/locus_tag="B1761_06700"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001018251.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S15" /protein_id="AQW33943.1"
gene complement(1217914..1218495)
/locus_tag="B1761_06705"
CDS complement(1217914..1218495)
/locus_tag="B1761_06705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225359.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="VanZ family protein"
/protein_id="AQW33944.1"
gene 1219321..1219428
/locus_tag="B1761_06710"
CDS 1219321..1219428
/locus_tag="B1761_06710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949251.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LPXTG cell wall anchor domain-containing
protein"
/protein_id="AQW33945.1"
gene complement(1219515..1220255)
/locus_tag="B1761_06715"
CDS complement(1219515..1220255)
/locus_tag="B1761_06715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886432.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter"
/protein_id="AQW33946.1"
gene complement(1220255..1221805)
/locus_tag="B1761_06720"
CDS complement(1220255..1221805)
/locus_tag="B1761_06720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225362.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine ABC transporter substrate-binding
protein"
/protein_id="AQW33947.1"
gene 1222008..1222862
/locus_tag="B1761_06725"
CDS 1222008..1222862
/locus_tag="B1761_06725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535722.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="undecaprenyl-diphosphatase"
/protein_id="AQW33948.1"
gene complement(1222952..1223247)
/locus_tag="B1761_06730"
/pseudo
CDS complement(1222952..1223247)
/locus_tag="B1761_06730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183849.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1223512..1224261
/locus_tag="B1761_06735"
CDS 1223512..1224261
/locus_tag="B1761_06735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633817.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="adaptor protein MecA"
/protein_id="AQW33949.1"
gene 1224265..1225422
/locus_tag="B1761_06740"
CDS 1224265..1225422
/locus_tag="B1761_06740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098132.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="undecaprenyl-phosphate
alpha-N-acetylglucosaminyl 1-phosphate transferase"
/protein_id="AQW33950.1"
gene 1225582..1226352
/locus_tag="B1761_06745"
CDS 1225582..1226352
/locus_tag="B1761_06745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883600.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW33951.1"
gene 1226389..1227651
/locus_tag="B1761_06750"
CDS 1226389..1227651
/locus_tag="B1761_06750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013989976.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Fe-S cluster assembly protein SufD"
/protein_id="AQW33952.1"
gene 1227705..1228937
/locus_tag="B1761_06755"
CDS 1227705..1228937
/locus_tag="B1761_06755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949261.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cysteine desulfurase"
/protein_id="AQW33953.1"
gene 1228924..1229358
/locus_tag="B1761_06760"
CDS 1228924..1229358
/locus_tag="B1761_06760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727300.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="iron-sulfur cluster assembly scaffold protein"
/protein_id="AQW33954.1"
gene 1229438..1230856
/locus_tag="B1761_06765"
CDS 1229438..1230856
/locus_tag="B1761_06765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017769002.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Fe-S cluster assembly protein SufB"
/protein_id="AQW33955.1"
gene 1231140..1232152
/locus_tag="B1761_06770"
/pseudo
CDS 1231140..1232152
/locus_tag="B1761_06770"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098122.1"
/note="frameshifted; incomplete; partial on complete
genome; missing stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ABC transporter substrate-binding protein"
gene 1232163..1232372
/locus_tag="B1761_06775"
CDS 1232163..1232372
/locus_tag="B1761_06775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947651.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33956.1"
gene 1232380..1233417
/locus_tag="B1761_06780"
/pseudo
CDS 1232380..1233417
/locus_tag="B1761_06780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004347296.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptide ABC transporter permease"
gene 1233431..1234473
/locus_tag="B1761_06785"
/pseudo
CDS 1233431..1234473
/locus_tag="B1761_06785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002274589.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
gene 1234475..1235413
/locus_tag="B1761_06790"
/pseudo
CDS 1234475..1235413
/locus_tag="B1761_06790"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226817.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
gene 1235527..1235889
/locus_tag="B1761_06795"
CDS 1235527..1235889
/locus_tag="B1761_06795"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886442.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33957.1"
gene 1235970..1236836
/locus_tag="B1761_06800"
CDS 1235970..1236836
/locus_tag="B1761_06800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002994071.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="molecular chaperone Hsp33"
/protein_id="AQW33958.1"
gene 1236829..1237806
/locus_tag="B1761_06805"
CDS 1236829..1237806
/locus_tag="B1761_06805"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012657697.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA dihydrouridine synthase DusB"
/protein_id="AQW33959.1"
gene 1238035..1239303
/locus_tag="B1761_06810"
CDS 1238035..1239303
/locus_tag="B1761_06810"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225384.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase"
/protein_id="AQW33960.1"
gene 1239409..1239852
/locus_tag="B1761_06815"
CDS 1239409..1239852
/locus_tag="B1761_06815"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727304.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33961.1"
gene 1239854..1240561
/locus_tag="B1761_06820"
CDS 1239854..1240561
/locus_tag="B1761_06820"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883613.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="zinc ABC transporter ATP-binding protein"
/protein_id="AQW33962.1"
gene 1240554..1241366
/locus_tag="B1761_06825"
CDS 1240554..1241366
/locus_tag="B1761_06825"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727306.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="zinc ABC transporter permease"
/protein_id="AQW33963.1"
gene 1241528..1242466
/locus_tag="B1761_06830"
CDS 1241528..1242466
/locus_tag="B1761_06830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098108.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="malate transporter"
/protein_id="AQW33964.1"
gene 1242617..1243012
/locus_tag="B1761_06835"
CDS 1242617..1243012
/locus_tag="B1761_06835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607909.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PTS glucose transporter subunit IIA"
/protein_id="AQW33965.1"
gene 1243024..1243242
/locus_tag="B1761_06840"
/pseudo
CDS 1243024..1243242
/locus_tag="B1761_06840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949300.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="PTS glucose transporter subunit IIABC"
gene 1243258..1244803
/locus_tag="B1761_06845"
/pseudo
CDS 1243258..1244803
/locus_tag="B1761_06845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003013424.1"
/note="phosphoenolpyruvate-dependent sugar
phosphotransferase system; catalyzes the phosphorylation
of incoming sugar substrates concomitant with their
translocation across the cell membrane; IIB is
phosphorylated by IIA and then transfers the phosphoryl
group to the sugar; IIC forms the translocation channel;
frameshifted; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="PTS glucose/maltose transporter subunit IIBCA"
gene 1244904..1245716
/locus_tag="B1761_06850"
CDS 1244904..1245716
/locus_tag="B1761_06850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006595762.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hydrolase"
/protein_id="AQW33966.1"
gene 1245825..1247174
/gene="pgi"
/locus_tag="B1761_06855"
CDS 1245825..1247174
/gene="pgi"
/locus_tag="B1761_06855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016399450.1"
/note="functions in sugar metabolism in glycolysis and the
Embden-Meyerhof pathways (EMP) and in gluconeogenesis;
catalyzes reversible isomerization of glucose-6-phosphate
to fructose-6-phosphate; member of PGI family; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glucose-6-phosphate isomerase"
/protein_id="AQW33967.1"
gene 1247362..1248078
/locus_tag="B1761_06860"
CDS 1247362..1248078
/locus_tag="B1761_06860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013989989.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33968.1"
gene 1248204..1248542
/locus_tag="B1761_06865"
CDS 1248204..1248542
/locus_tag="B1761_06865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225395.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="preprotein translocase subunit YajC"
/protein_id="AQW33969.1"
gene 1248671..1249420
/locus_tag="B1761_06870"
CDS 1248671..1249420
/locus_tag="B1761_06870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098100.1"
/note="catalyzes the formation of undecaprenyl
pyrophosphate from isopentenyl pyrophosphate; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="isoprenyl transferase"
/protein_id="AQW33970.1"
gene 1249433..1250227
/locus_tag="B1761_06875"
CDS 1249433..1250227
/locus_tag="B1761_06875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889800.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphatidate cytidylyltransferase"
/protein_id="AQW33971.1"
gene 1250244..1251506
/locus_tag="B1761_06880"
CDS 1250244..1251506
/locus_tag="B1761_06880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225396.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RIP metalloprotease RseP"
/protein_id="AQW33972.1"
gene 1251592..1253439
/locus_tag="B1761_06885"
CDS 1251592..1253439
/locus_tag="B1761_06885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607914.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="proline--tRNA ligase"
/protein_id="AQW33973.1"
gene 1254056..1255996
/locus_tag="B1761_06890"
CDS 1254056..1255996
/locus_tag="B1761_06890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633830.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW33974.1"
gene 1255996..1256799
/locus_tag="B1761_06895"
CDS 1255996..1256799
/locus_tag="B1761_06895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889814.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW33975.1"
gene 1256971..1257258
/locus_tag="B1761_06900"
CDS 1256971..1257258
/locus_tag="B1761_06900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013989994.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="co-chaperone GroES"
/protein_id="AQW33976.1"
gene 1257307..1258926
/locus_tag="B1761_06905"
CDS 1257307..1258926
/locus_tag="B1761_06905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633644.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="molecular chaperone GroEL"
/protein_id="AQW33977.1"
gene 1259020..1259864
/locus_tag="B1761_06910"
/pseudo
CDS 1259020..1259864
/locus_tag="B1761_06910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001858053.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene 1260048..1260119
/locus_tag="B1761_06915"
CDS 1260048..1260119
/locus_tag="B1761_06915"
/inference="COORDINATES: protein motif:HMM:PF13333.4"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34541.1"
gene complement(1260338..1260646)
/locus_tag="B1761_06920"
CDS complement(1260338..1260646)
/locus_tag="B1761_06920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680689.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33978.1"
gene complement(1261156..1261461)
/locus_tag="B1761_06925"
CDS complement(1261156..1261461)
/locus_tag="B1761_06925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098092.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33979.1"
gene complement(1261461..1261793)
/locus_tag="B1761_06930"
CDS complement(1261461..1261793)
/locus_tag="B1761_06930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946909.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33980.1"
gene complement(1261973..1262845)
/locus_tag="B1761_06935"
CDS complement(1261973..1262845)
/locus_tag="B1761_06935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607922.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA pseudouridine synthase"
/protein_id="AQW33981.1"
gene 1262911..1265238
/locus_tag="B1761_06940"
CDS 1262911..1265238
/locus_tag="B1761_06940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607923.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="penicillin-binding protein"
/protein_id="AQW33982.1"
gene 1265287..1265439
/locus_tag="B1761_06945"
CDS 1265287..1265439
/locus_tag="B1761_06945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015912025.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L33"
/protein_id="AQW33983.1"
gene 1265448..1265624
/locus_tag="B1761_06950"
CDS 1265448..1265624
/locus_tag="B1761_06950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949373.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="preprotein translocase subunit SecE"
/protein_id="AQW33984.1"
gene 1265821..1266360
/locus_tag="B1761_06955"
CDS 1265821..1266360
/locus_tag="B1761_06955"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003086790.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcription termination/antitermination
protein NusG"
/protein_id="AQW33985.1"
gene 1266482..1266970
/locus_tag="B1761_06960"
CDS 1266482..1266970
/locus_tag="B1761_06960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607924.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphatase PAP2 family protein"
/protein_id="AQW33986.1"
gene complement(1267102..1267911)
/locus_tag="B1761_06965"
/pseudo
CDS complement(1267102..1267911)
/locus_tag="B1761_06965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633838.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hydrolase"
gene complement(1267907..1268671)
/locus_tag="B1761_06970"
CDS complement(1267907..1268671)
/locus_tag="B1761_06970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607925.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cytochrome C"
/protein_id="AQW33987.1"
gene 1268845..1271346
/locus_tag="B1761_06975"
CDS 1268845..1271346
/locus_tag="B1761_06975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008809778.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="leucine--tRNA ligase"
/protein_id="AQW33988.1"
gene 1271435..1271626
/locus_tag="B1761_06980"
CDS 1271435..1271626
/locus_tag="B1761_06980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949384.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33989.1"
gene 1271643..1271999
/locus_tag="B1761_06985"
CDS 1271643..1271999
/locus_tag="B1761_06985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004241355.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW33990.1"
gene 1272044..1272568
/locus_tag="B1761_06990"
/pseudo
CDS 1272044..1272568
/locus_tag="B1761_06990"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727311.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="acyl-CoA thioesterase"
gene 1272519..1273277
/locus_tag="B1761_06995"
CDS 1272519..1273277
/locus_tag="B1761_06995"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947928.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acyl-CoA thioesterase"
/protein_id="AQW33991.1"
gene 1273570..1275024
/locus_tag="B1761_07000"
CDS 1273570..1275024
/locus_tag="B1761_07000"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680698.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nicotinate phosphoribosyltransferase"
/protein_id="AQW33992.1"
gene 1275036..1275857
/locus_tag="B1761_07005"
CDS 1275036..1275857
/locus_tag="B1761_07005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949400.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NAD(+) synthetase"
/protein_id="AQW33993.1"
gene 1275873..1276313
/locus_tag="B1761_07010"
CDS 1275873..1276313
/locus_tag="B1761_07010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949401.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF805 domain-containing protein"
/protein_id="AQW33994.1"
gene 1276415..1277752
/locus_tag="B1761_07015"
CDS 1276415..1277752
/locus_tag="B1761_07015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003098056.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminopeptidase C"
/protein_id="AQW33995.1"
gene 1277882..1279210
/locus_tag="B1761_07020"
CDS 1277882..1279210
/locus_tag="B1761_07020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607930.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
/protein_id="AQW33996.1"
gene complement(1279286..1281628)
/locus_tag="B1761_07025"
CDS complement(1279286..1281628)
/locus_tag="B1761_07025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225418.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="penicillin-binding protein"
/protein_id="AQW33997.1"
gene complement(1281628..1282224)
/locus_tag="B1761_07030"
CDS complement(1281628..1282224)
/locus_tag="B1761_07030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094999.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Holliday junction resolvase RecU"
/protein_id="AQW33998.1"
gene 1282301..1282816
/locus_tag="B1761_07035"
CDS 1282301..1282816
/locus_tag="B1761_07035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949411.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW33999.1"
gene 1282925..1283257
/locus_tag="B1761_07040"
CDS 1282925..1283257
/locus_tag="B1761_07040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949413.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell cycle protein GpsB"
/protein_id="AQW34000.1"
gene 1283273..1283644
/gene="rnpB"
/locus_tag="B1761_07045"
ncRNA 1283273..1283644
/ncRNA_class="RNase_P_RNA"
/gene="rnpB"
/locus_tag="B1761_07045"
/product="RNase P RNA component class B"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00011"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00011"
gene 1283794..1284960
/locus_tag="B1761_07050"
CDS 1283794..1284960
/locus_tag="B1761_07050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183740.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA methyltransferase"
/protein_id="AQW34001.1"
gene 1284963..1286825
/locus_tag="B1761_07055"
CDS 1284963..1286825
/locus_tag="B1761_07055"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621127.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34002.1"
gene 1286936..1290031
/locus_tag="B1761_07060"
CDS 1286936..1290031
/locus_tag="B1761_07060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947757.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA helicase"
/protein_id="AQW34003.1"
gene 1290187..1290903
/locus_tag="B1761_07065"
CDS 1290187..1290903
/locus_tag="B1761_07065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886515.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34004.1"
gene 1290930..1292258
/locus_tag="B1761_07070"
CDS 1290930..1292258
/locus_tag="B1761_07070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095189.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylmuramate--L-alanine ligase"
/protein_id="AQW34005.1"
gene 1292344..1292811
/locus_tag="B1761_07075"
CDS 1292344..1292811
/locus_tag="B1761_07075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949439.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetyltransferase"
/protein_id="AQW34006.1"
gene 1292911..1294887
/locus_tag="B1761_07080"
CDS 1292911..1294887
/locus_tag="B1761_07080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225427.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminodeoxychorismate lyase"
/protein_id="AQW34007.1"
gene 1294972..1295454
/locus_tag="B1761_07085"
CDS 1294972..1295454
/locus_tag="B1761_07085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018363781.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcription elongation factor GreA"
/protein_id="AQW34008.1"
gene 1295859..1296348
/locus_tag="B1761_07090"
/pseudo
CDS 1295859..1296348
/locus_tag="B1761_07090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680582.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(1296404..1297321)
/locus_tag="B1761_07095"
CDS complement(1296404..1297321)
/locus_tag="B1761_07095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004183725.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="membrane protein insertase YidC"
/protein_id="AQW34009.1"
gene complement(1297408..1297686)
/locus_tag="B1761_07100"
CDS complement(1297408..1297686)
/locus_tag="B1761_07100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376481.1"
/note="catalyzes the hydrolysis of acylphosphate; Derived
by automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acylphosphatase"
/protein_id="AQW34010.1"
gene 1297789..1298526
/locus_tag="B1761_07105"
CDS 1297789..1298526
/locus_tag="B1761_07105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226845.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="23S rRNA methyltransferase"
/protein_id="AQW34011.1"
gene 1298628..1299122
/locus_tag="B1761_07110"
CDS 1298628..1299122
/locus_tag="B1761_07110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016481115.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HAD family hydrolase"
/protein_id="AQW34012.1"
gene 1299156..1299845
/locus_tag="B1761_07115"
CDS 1299156..1299845
/locus_tag="B1761_07115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002262553.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34013.1"
gene complement(1299956..1300905)
/locus_tag="B1761_07120"
/pseudo
CDS complement(1299956..1300905)
/locus_tag="B1761_07120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092193.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="DUF5105 domain-containing protein"
gene 1301152..1302405
/locus_tag="B1761_07125"
CDS 1301152..1302405
/locus_tag="B1761_07125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607943.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="diaminopimelate decarboxylase"
/protein_id="AQW34014.1"
gene complement(1302434..1302973)
/locus_tag="B1761_07130"
CDS complement(1302434..1302973)
/locus_tag="B1761_07130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607944.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="TetR family transcriptional regulator"
/protein_id="AQW34015.1"
gene 1303214..1303459
/locus_tag="B1761_07135"
CDS 1303214..1303459
/locus_tag="B1761_07135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949478.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34016.1"
gene 1303525..1304340
/locus_tag="B1761_07140"
CDS 1303525..1304340
/locus_tag="B1761_07140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092217.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamate racemase"
/protein_id="AQW34017.1"
gene 1304333..1305307
/locus_tag="B1761_07145"
CDS 1304333..1305307
/locus_tag="B1761_07145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883637.1"
/note="HAM1-like protein; Rec-dependent growth; RgdB;
yggV; it is suspected that this protein functions to
remove misincorporated bases such as xanthine or
hypoxanthine; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="non-canonical purine NTP pyrophosphatase"
/protein_id="AQW34018.1"
gene 1305289..1305810
/locus_tag="B1761_07150"
CDS 1305289..1305810
/locus_tag="B1761_07150"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947479.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphodiesterase"
/protein_id="AQW34019.1"
gene 1305807..1306289
/locus_tag="B1761_07155"
CDS 1305807..1306289
/locus_tag="B1761_07155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889901.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CBS domain-containing protein"
/protein_id="AQW34020.1"
gene 1306243..1307004
/locus_tag="B1761_07160"
CDS 1306243..1307004
/locus_tag="B1761_07160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607947.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="site-specific tyrosine recombinase XerD"
/protein_id="AQW34021.1"
gene 1307004..1307717
/locus_tag="B1761_07165"
CDS 1307004..1307717
/locus_tag="B1761_07165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949492.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="segregation/condensation protein A"
/protein_id="AQW34022.1"
gene 1307710..1308291
/gene="scpB"
/locus_tag="B1761_07170"
CDS 1307710..1308291
/gene="scpB"
/locus_tag="B1761_07170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990032.1"
/note="functions during chromosome segregation; may form a
condensin-like structure with SMC and ScpA; forms a
homodimer; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="segregation/condensation protein B"
/protein_id="AQW34023.1"
gene 1308384..1309109
/locus_tag="B1761_07175"
CDS 1308384..1309109
/locus_tag="B1761_07175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883686.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pseudouridine synthase"
/protein_id="AQW34542.1"
gene 1309106..1309357
/locus_tag="B1761_07180"
CDS 1309106..1309357
/locus_tag="B1761_07180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949499.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="membrane protein insertion efficiency factor
YidD"
/protein_id="AQW34024.1"
gene complement(1309380..1310819)
/locus_tag="B1761_07185"
CDS complement(1309380..1310819)
/locus_tag="B1761_07185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621136.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="potassium transporter KefA"
/protein_id="AQW34025.1"
gene complement(1310826..1312175)
/locus_tag="B1761_07190"
CDS complement(1310826..1312175)
/locus_tag="B1761_07190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092246.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="Trk system potassium transport protein TrkA"
/protein_id="AQW34026.1"
gene 1312464..1312973
/locus_tag="B1761_07195"
CDS 1312464..1312973
/locus_tag="B1761_07195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949522.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA
(uridine(34)/cytosine(34)/5-
carboxymethylaminomethyluridine(34)-2'-O)-
methyltransferase TrmL"
/protein_id="AQW34027.1"
regulatory 1313080..1313202
/regulatory_class="riboswitch"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00050"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="FMN riboswitch; Derived by automated computational
analysis using gene prediction method: cmsearch."
/bound_moiety="flavin mononucleotide"
/db_xref="RFAM:RF00050"
gene 1313285..1313842
/locus_tag="B1761_07200"
CDS 1313285..1313842
/locus_tag="B1761_07200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946140.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ECF transporter S component"
/protein_id="AQW34028.1"
gene 1313845..1314495
/locus_tag="B1761_07205"
CDS 1313845..1314495
/locus_tag="B1761_07205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535842.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphatase PAP2 family protein"
/protein_id="AQW34029.1"
gene 1314690..1315589
/locus_tag="B1761_07210"
CDS 1314690..1315589
/locus_tag="B1761_07210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883753.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW34030.1"
gene 1315764..1315988
/locus_tag="B1761_07215"
CDS 1315764..1315988
/locus_tag="B1761_07215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607954.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
/protein_id="AQW34031.1"
gene 1316019..1316683
/locus_tag="B1761_07220"
/pseudo
CDS 1316019..1316683
/locus_tag="B1761_07220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949527.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
gene 1316714..1316953
/locus_tag="B1761_07225"
CDS 1316714..1316953
/locus_tag="B1761_07225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226855.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
/protein_id="AQW34032.1"
gene 1317041..1317460
/locus_tag="B1761_07230"
/pseudo
CDS 1317041..1317460
/locus_tag="B1761_07230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949535.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
gene 1317439..1317858
/locus_tag="B1761_07235"
CDS 1317439..1317858
/locus_tag="B1761_07235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946148.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide ABC transporter ATP-binding protein"
/protein_id="AQW34033.1"
gene 1317966..1318283
/locus_tag="B1761_07240"
CDS 1317966..1318283
/locus_tag="B1761_07240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949539.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF805 domain-containing protein"
/protein_id="AQW34034.1"
gene complement(1318246..1319663)
/locus_tag="B1761_07245"
/pseudo
CDS complement(1318246..1319663)
/locus_tag="B1761_07245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883799.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="urease cluster protein"
gene 1320071..1320586
/locus_tag="B1761_07250"
CDS 1320071..1320586
/locus_tag="B1761_07250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889220.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acid-activated urea channel"
/protein_id="AQW34035.1"
gene 1320611..1320913
/locus_tag="B1761_07255"
CDS 1320611..1320913
/locus_tag="B1761_07255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003694776.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="urease subunit gamma"
/protein_id="AQW34036.1"
gene 1320925..1321236
/locus_tag="B1761_07260"
CDS 1320925..1321236
/locus_tag="B1761_07260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886559.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="urease subunit beta"
/protein_id="AQW34037.1"
gene 1321252..1322970
/locus_tag="B1761_07265"
CDS 1321252..1322970
/locus_tag="B1761_07265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680721.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="urease subunit alpha"
/protein_id="AQW34038.1"
gene 1323111..1323563
/locus_tag="B1761_07270"
CDS 1323111..1323563
/locus_tag="B1761_07270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949549.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="urease accessory protein UreE"
/protein_id="AQW34039.1"
gene 1323553..1324266
/locus_tag="B1761_07275"
CDS 1323553..1324266
/locus_tag="B1761_07275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889927.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="urease accessory protein UreF"
/protein_id="AQW34040.1"
gene 1324296..1324910
/locus_tag="B1761_07280"
CDS 1324296..1324910
/locus_tag="B1761_07280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889216.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="urease accessory protein UreG"
/protein_id="AQW34041.1"
gene 1324912..1325751
/locus_tag="B1761_07285"
CDS 1324912..1325751
/locus_tag="B1761_07285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226862.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="urease accessory protein UreD"
/protein_id="AQW34042.1"
gene 1325755..1326732
/locus_tag="B1761_07290"
CDS 1325755..1326732
/locus_tag="B1761_07290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949556.1"
/note="catalyzes the ATP-dependent transport of cobalt;
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cobalamin biosynthesis protein CbiM"
/protein_id="AQW34043.1"
gene 1326729..1327508
/locus_tag="B1761_07295"
CDS 1326729..1327508
/locus_tag="B1761_07295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949558.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cobalt ABC transporter permease"
/protein_id="AQW34044.1"
gene 1327510..1328223
/locus_tag="B1761_07300"
CDS 1327510..1328223
/locus_tag="B1761_07300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680724.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cobalt ABC transporter ATP-binding protein"
/protein_id="AQW34045.1"
gene 1328388..1329236
/locus_tag="B1761_07305"
CDS 1328388..1329236
/locus_tag="B1761_07305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225460.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter substrate-binding
protein"
/protein_id="AQW34046.1"
gene 1329426..1332317
/locus_tag="B1761_07310"
CDS 1329426..1332317
/locus_tag="B1761_07310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621152.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide synthetase"
/protein_id="AQW34047.1"
gene 1332314..1333960
/locus_tag="B1761_07315"
CDS 1332314..1333960
/locus_tag="B1761_07315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225462.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NUDIX hydrolase"
/protein_id="AQW34048.1"
gene 1333986..1335194
/locus_tag="B1761_07320"
CDS 1333986..1335194
/locus_tag="B1761_07320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225463.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MFS transporter"
/protein_id="AQW34049.1"
gene complement(1335393..1335772)
/locus_tag="B1761_07325"
/pseudo
CDS complement(1335393..1335772)
/locus_tag="B1761_07325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003100562.1"
/note="frameshifted; incomplete; partial on complete
genome; missing start; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS110 family transposase"
gene 1335901..1336749
/locus_tag="B1761_07330"
CDS 1335901..1336749
/locus_tag="B1761_07330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225460.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid ABC transporter substrate-binding
protein"
/protein_id="AQW34050.1"
gene 1336909..1337811
/locus_tag="B1761_07335"
CDS 1336909..1337811
/locus_tag="B1761_07335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607957.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="O-sialoglycoprotein endopeptidase"
/protein_id="AQW34051.1"
gene 1337873..1339246
/locus_tag="B1761_07340"
/pseudo
CDS 1337873..1339246
/locus_tag="B1761_07340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002307175.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptidase M20"
gene 1339239..1340306
/locus_tag="B1761_07345"
CDS 1339239..1340306
/locus_tag="B1761_07345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535867.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="methionine import ATP-binding protein MetN"
/protein_id="AQW34052.1"
gene 1340306..1340998
/locus_tag="B1761_07350"
CDS 1340306..1340998
/locus_tag="B1761_07350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949605.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="methionine ABC transporter permease"
/protein_id="AQW34053.1"
gene 1341121..1342329
/locus_tag="B1761_07355"
CDS 1341121..1342329
/locus_tag="B1761_07355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949607.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine/threonine transporter SstT"
/protein_id="AQW34054.1"
gene 1342482..1343330
/locus_tag="B1761_07360"
CDS 1342482..1343330
/locus_tag="B1761_07360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889197.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-directed RNA polymerase subunit delta"
/protein_id="AQW34055.1"
gene 1343340..1343884
/locus_tag="B1761_07365"
/pseudo
CDS 1343340..1343884
/locus_tag="B1761_07365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092236.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ECF transporter S component"
gene 1343950..1345626
/locus_tag="B1761_07370"
CDS 1343950..1345626
/locus_tag="B1761_07370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883718.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="heme ABC transporter ATP-binding protein"
/protein_id="AQW34056.1"
gene 1345619..1346449
/locus_tag="B1761_07375"
CDS 1345619..1346449
/locus_tag="B1761_07375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952521.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cobalt ABC transporter permease"
/protein_id="AQW34057.1"
gene 1346659..1348635
/locus_tag="B1761_07380"
CDS 1346659..1348635
/locus_tag="B1761_07380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092196.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transketolase"
/protein_id="AQW34058.1"
gene 1348697..1348948
/locus_tag="B1761_07385"
CDS 1348697..1348948
/locus_tag="B1761_07385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949630.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ascorbate 6-phosphate lactonase"
/protein_id="AQW34543.1"
gene complement(1348884..1349555)
/locus_tag="B1761_07390"
CDS complement(1348884..1349555)
/locus_tag="B1761_07390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889958.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="potassium transporter Trk"
/protein_id="AQW34059.1"
gene complement(1349595..1350980)
/locus_tag="B1761_07395"
CDS complement(1349595..1350980)
/locus_tag="B1761_07395"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889959.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATPase V"
/protein_id="AQW34060.1"
gene complement(1351029..1351742)
/locus_tag="B1761_07400"
CDS complement(1351029..1351742)
/locus_tag="B1761_07400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018375763.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosomal RNA small subunit methyltransferase G"
/protein_id="AQW34061.1"
gene 1352039..1352575
/locus_tag="B1761_07405"
CDS 1352039..1352575
/locus_tag="B1761_07405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946488.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
/protein_id="AQW34062.1"
gene 1352731..1353420
/locus_tag="B1761_07410"
CDS 1352731..1353420
/locus_tag="B1761_07410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011527876.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
/protein_id="AQW34063.1"
gene 1353417..1354934
/locus_tag="B1761_07415"
CDS 1353417..1354934
/locus_tag="B1761_07415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949640.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="two-component sensor histidine kinase"
/protein_id="AQW34064.1"
gene 1355056..1355535
/locus_tag="B1761_07420"
CDS 1355056..1355535
/locus_tag="B1761_07420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019783462.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NrdR family transcriptional regulator"
/protein_id="AQW34065.1"
gene 1355532..1356707
/locus_tag="B1761_07425"
CDS 1355532..1356707
/locus_tag="B1761_07425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889965.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chromosome replication initiation protein"
/protein_id="AQW34066.1"
gene 1356711..1357613
/locus_tag="B1761_07430"
CDS 1356711..1357613
/locus_tag="B1761_07430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607971.1"
/note="Primosomal protein that may act to load helicase
DnaC during DNA replication; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="primosomal protein DnaI"
/protein_id="AQW34067.1"
gene 1357719..1359029
/locus_tag="B1761_07435"
CDS 1357719..1359029
/locus_tag="B1761_07435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018377046.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTPase Der"
/protein_id="AQW34068.1"
gene 1359402..1359752
/locus_tag="B1761_07440"
CDS 1359402..1359752
/locus_tag="B1761_07440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680745.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34069.1"
gene 1359755..1360333
/locus_tag="B1761_07445"
/pseudo
CDS 1359755..1360333
/locus_tag="B1761_07445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092215.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="cysteine hydrolase"
gene complement(1360367..1360954)
/locus_tag="B1761_07450"
/pseudo
CDS complement(1360367..1360954)
/locus_tag="B1761_07450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002263573.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(1360930..1361195)
/locus_tag="B1761_07455"
/pseudo
CDS complement(1360930..1361195)
/locus_tag="B1761_07455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681422.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(1361274..1361465)
/locus_tag="B1761_07460"
CDS complement(1361274..1361465)
/locus_tag="B1761_07460"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680746.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="helix-turn-helix domain containing protein"
/protein_id="AQW34070.1"
gene complement(1362406..1363683)
/locus_tag="B1761_07465"
CDS complement(1362406..1363683)
/locus_tag="B1761_07465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946517.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine--tRNA ligase"
/protein_id="AQW34544.1"
gene complement(1363892..1364266)
/locus_tag="B1761_07470"
CDS complement(1363892..1364266)
/locus_tag="B1761_07470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092275.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PTS mannose transporter accessory protein ManO"
/protein_id="AQW34071.1"
gene complement(1364345..1365256)
/locus_tag="B1761_07475"
CDS complement(1364345..1365256)
/locus_tag="B1761_07475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014638556.1"
/note="hosphoenolpyruvate-dependent sugar
phosphotransferase system catalyzes the phosphorylation of
incoming sugar substrates concomitant with their
translocation across the cell membrane; IID with IIC forms
the translocation channel; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/codon_start=1
/transl_table=11
/product="PTS mannose family transporter subunit IID"
/protein_id="AQW34072.1"
gene complement(1365271..1366098)
/locus_tag="B1761_07480"
CDS complement(1365271..1366098)
/locus_tag="B1761_07480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014638555.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PTS mannose/fructose/sorbose transporter subunit
IIC"
/protein_id="AQW34073.1"
gene complement(1366166..1367158)
/locus_tag="B1761_07485"
CDS complement(1366166..1367158)
/locus_tag="B1761_07485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226875.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PTS mannose transporter subunit EIIAB"
/protein_id="AQW34074.1"
gene 1367534..1368265
/locus_tag="B1761_07490"
CDS 1367534..1368265
/locus_tag="B1761_07490"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014713635.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cyclase"
/protein_id="AQW34075.1"
gene complement(1368310..1369122)
/locus_tag="B1761_07495"
CDS complement(1368310..1369122)
/locus_tag="B1761_07495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952550.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HAD family hydrolase"
/protein_id="AQW34076.1"
gene 1369331..1370752
/locus_tag="B1761_07500"
CDS 1369331..1370752
/locus_tag="B1761_07500"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952551.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NCS2 family permease"
/protein_id="AQW34077.1"
gene 1371024..1371467
/locus_tag="B1761_07505"
CDS 1371024..1371467
/locus_tag="B1761_07505"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633907.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA
(adenosine(37)-N6)-threonylcarbamoyltransferase complex
ATPase subunit type 1 TsaE"
/protein_id="AQW34078.1"
gene 1371460..1371981
/locus_tag="B1761_07510"
CDS 1371460..1371981
/locus_tag="B1761_07510"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883807.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GNAT family N-acetyltransferase"
/protein_id="AQW34079.1"
gene 1371990..1373216
/locus_tag="B1761_07515"
CDS 1371990..1373216
/locus_tag="B1761_07515"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949682.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transporter"
/protein_id="AQW34080.1"
gene 1373357..1373830
/locus_tag="B1761_07520"
CDS 1373357..1373830
/locus_tag="B1761_07520"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883745.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosome maturation factor RimP"
/protein_id="AQW34081.1"
gene 1373896..1375083
/locus_tag="B1761_07525"
CDS 1373896..1375083
/locus_tag="B1761_07525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225496.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcription termination/antitermination
protein NusA"
/protein_id="AQW34082.1"
gene 1375104..1375400
/locus_tag="B1761_07530"
CDS 1375104..1375400
/locus_tag="B1761_07530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006531117.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
/protein_id="AQW34083.1"
gene 1375393..1375695
/locus_tag="B1761_07535"
CDS 1375393..1375695
/locus_tag="B1761_07535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003052320.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34084.1"
gene 1375714..1378545
/locus_tag="B1761_07540"
CDS 1375714..1378545
/locus_tag="B1761_07540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621166.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="translation initiation factor IF-2"
/protein_id="AQW34085.1"
gene 1378639..1378992
/locus_tag="B1761_07545"
CDS 1378639..1378992
/locus_tag="B1761_07545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003092174.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosome-binding factor A"
/protein_id="AQW34086.1"
gene 1379057..1379622
/locus_tag="B1761_07550"
/pseudo
CDS 1379057..1379622
/locus_tag="B1761_07550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633913.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="Rossman fold protein, TIGR00730 family"
gene 1379912..1381146
/locus_tag="B1761_07555"
/pseudo
CDS 1379912..1381146
/locus_tag="B1761_07555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947454.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="peptidoglycan branched peptide synthesis
protein"
gene complement(1381215..1382660)
/locus_tag="B1761_07560"
CDS complement(1381215..1382660)
/locus_tag="B1761_07560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990079.1"
/note="involved in cell wall formation; peptidoglycan
synthesis; cytoplasmic enzyme; catalyzes the addition of
lysine to UDP-N-acetylmuramoyl-L-alanyl-D-glutamate
forming UDP-N-acetylmuramoyl-L-alanyl-D-glutamyl-L-lysine;
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-
lysine ligase"
/protein_id="AQW34087.1"
gene 1382755..1384386
/locus_tag="B1761_07565"
CDS 1382755..1384386
/locus_tag="B1761_07565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226883.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="polysaccharide biosynthesis protein"
/protein_id="AQW34088.1"
gene 1384410..1385021
/locus_tag="B1761_07570"
CDS 1384410..1385021
/locus_tag="B1761_07570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621171.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hydrolase"
/protein_id="AQW34089.1"
gene 1385325..1386419
/locus_tag="B1761_07575"
CDS 1385325..1386419
/locus_tag="B1761_07575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946733.1"
/note="catalyzes the formation of cystathionine from
L-cysteine and O-succinyl-L-homoserine; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cystathionine gamma-synthase"
/protein_id="AQW34090.1"
gene 1386430..1387593
/locus_tag="B1761_07580"
CDS 1386430..1387593
/locus_tag="B1761_07580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680761.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cysteine desulfurase"
/protein_id="AQW34091.1"
gene 1387669..1387836
/locus_tag="B1761_07585"
CDS 1387669..1387836
/locus_tag="B1761_07585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949727.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="levansucrase"
/protein_id="AQW34092.1"
gene 1387877..1388151
/locus_tag="B1761_07590"
/pseudo
CDS 1387877..1388151
/locus_tag="B1761_07590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949729.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1388281..1388910
/locus_tag="B1761_07595"
CDS 1388281..1388910
/locus_tag="B1761_07595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883819.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="uracil phosphoribosyltransferase"
/protein_id="AQW34093.1"
gene 1389048..1389638
/locus_tag="B1761_07600"
CDS 1389048..1389638
/locus_tag="B1761_07600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018165400.1"
/note="hydrolyzes proteins to small peptides; with the
ATPase subunits ClpA or ClpX, ClpP degrades specific
substrates; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-dependent Clp protease proteolytic subunit"
/protein_id="AQW34094.1"
gene 1389725..1390174
/locus_tag="B1761_07605"
CDS 1389725..1390174
/locus_tag="B1761_07605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225507.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34095.1"
gene 1390167..1390448
/locus_tag="B1761_07610"
CDS 1390167..1390448
/locus_tag="B1761_07610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890011.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34096.1"
gene 1390605..1391780
/locus_tag="B1761_07615"
CDS 1390605..1391780
/locus_tag="B1761_07615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949737.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="branched-chain amino acid ABC transporter
substrate-binding protein"
/protein_id="AQW34097.1"
gene 1391824..1392708
/locus_tag="B1761_07620"
CDS 1391824..1392708
/locus_tag="B1761_07620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680766.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="branched-chain amino acid ABC transporter
permease"
/protein_id="AQW34098.1"
gene 1392712..1393662
/locus_tag="B1761_07625"
CDS 1392712..1393662
/locus_tag="B1761_07625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883720.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="branched-chain amino acid ABC transporter
permease"
/protein_id="AQW34099.1"
gene 1393665..1394429
/locus_tag="B1761_07630"
CDS 1393665..1394429
/locus_tag="B1761_07630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002311227.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW34100.1"
gene 1394429..1395139
/locus_tag="B1761_07635"
CDS 1394429..1395139
/locus_tag="B1761_07635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002262679.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW34101.1"
gene 1395275..1395935
/locus_tag="B1761_07640"
/pseudo
CDS 1395275..1395935
/locus_tag="B1761_07640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889134.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="acetoin utilization protein"
gene complement(1396102..1397028)
/locus_tag="B1761_07645"
CDS complement(1396102..1397028)
/locus_tag="B1761_07645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680768.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cysteine synthase A"
/protein_id="AQW34102.1"
gene complement(1397130..1397756)
/locus_tag="B1761_07650"
CDS complement(1397130..1397756)
/locus_tag="B1761_07650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890020.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="YigZ family protein"
/protein_id="AQW34103.1"
gene 1397811..1399130
/locus_tag="B1761_07655"
CDS 1397811..1399130
/locus_tag="B1761_07655"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097890.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA/RNA helicase"
/protein_id="AQW34104.1"
gene 1399111..1399773
/locus_tag="B1761_07660"
CDS 1399111..1399773
/locus_tag="B1761_07660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680771.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein"
/protein_id="AQW34105.1"
gene 1399852..1400400
/locus_tag="B1761_07665"
CDS 1399852..1400400
/locus_tag="B1761_07665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002988974.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosomal subunit interface protein"
/protein_id="AQW34106.1"
gene 1400810..1402364
/locus_tag="B1761_07670"
rRNA 1400810..1402364
/locus_tag="B1761_07670"
/product="16S ribosomal RNA"
gene 1402411..1402483
/locus_tag="B1761_07675"
tRNA 1402411..1402483
/locus_tag="B1761_07675"
/product="tRNA-Ala"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1402444..1402446,aa:Ala,seq:tgc)
gene 1402630..1405531
/locus_tag="B1761_07680"
rRNA 1402630..1405531
/locus_tag="B1761_07680"
/product="23S ribosomal RNA"
gene 1405614..1405729
/gene="rrf"
/locus_tag="B1761_07685"
rRNA 1405614..1405729
/gene="rrf"
/locus_tag="B1761_07685"
/product="5S ribosomal RNA"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00001"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00001"
gene 1405735..1405807
/locus_tag="B1761_07690"
tRNA 1405735..1405807
/locus_tag="B1761_07690"
/product="tRNA-Val"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1405768..1405770,aa:Val,seq:tac)
gene 1405810..1405882
/locus_tag="B1761_07695"
tRNA 1405810..1405882
/locus_tag="B1761_07695"
/product="tRNA-Asp"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1405843..1405845,aa:Asp,seq:gtc)
gene 1405902..1405974
/locus_tag="B1761_07700"
tRNA 1405902..1405974
/locus_tag="B1761_07700"
/product="tRNA-Lys"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1405935..1405937,aa:Lys,seq:ttt)
gene 1405980..1406061
/locus_tag="B1761_07705"
tRNA 1405980..1406061
/locus_tag="B1761_07705"
/product="tRNA-Leu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1406014..1406016,aa:Leu,seq:tag)
gene 1406077..1406149
/locus_tag="B1761_07710"
tRNA 1406077..1406149
/locus_tag="B1761_07710"
/product="tRNA-Thr"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1406110..1406112,aa:Thr,seq:tgt)
gene 1406157..1406228
/locus_tag="B1761_07715"
tRNA 1406157..1406228
/locus_tag="B1761_07715"
/product="tRNA-Glu"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1406190..1406192,aa:Glu,seq:ttc)
gene 1406318..1407250
/locus_tag="B1761_07720"
CDS 1406318..1407250
/locus_tag="B1761_07720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225519.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="manganese-dependent inorganic pyrophosphatase"
/protein_id="AQW34107.1"
gene 1407304..1407963
/locus_tag="B1761_07725"
CDS 1407304..1407963
/locus_tag="B1761_07725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225520.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34108.1"
gene complement(1407993..1408526)
/locus_tag="B1761_07730"
CDS complement(1407993..1408526)
/locus_tag="B1761_07730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000775318.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34109.1"
gene complement(1408597..1409373)
/locus_tag="B1761_07735"
CDS complement(1408597..1409373)
/locus_tag="B1761_07735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949763.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="regulatory protein RecX"
/protein_id="AQW34110.1"
gene 1409408..1410772
/locus_tag="B1761_07740"
CDS 1409408..1410772
/locus_tag="B1761_07740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197313.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="23S rRNA (uracil-5-)-methyltransferase RumA"
/protein_id="AQW34111.1"
gene 1410871..1411863
/locus_tag="B1761_07745"
CDS 1410871..1411863
/locus_tag="B1761_07745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016466857.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="asparagine synthetase A"
/protein_id="AQW34112.1"
gene complement(1412015..1413373)
/locus_tag="B1761_07750"
CDS complement(1412015..1413373)
/locus_tag="B1761_07750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949766.1"
/note="catalyzes the formation of 4-phospho-L-aspartate
from L-aspartate and ATP; lysine and threonine sensitive;
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartate kinase"
/protein_id="AQW34113.1"
gene 1413505..1414143
/locus_tag="B1761_07755"
CDS 1413505..1414143
/locus_tag="B1761_07755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095419.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HAD family hydrolase"
/protein_id="AQW34114.1"
gene 1414356..1415147
/locus_tag="B1761_07760"
CDS 1414356..1415147
/locus_tag="B1761_07760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002908889.1"
/note="Catalyzes the reversible hydration of unsaturated
fatty acyl-CoA to beta-hydroxyacyl-CoA; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="enoyl-CoA hydratase"
/protein_id="AQW34115.1"
gene 1415251..1415685
/locus_tag="B1761_07765"
CDS 1415251..1415685
/locus_tag="B1761_07765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002961461.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MarR family transcriptional regulator"
/protein_id="AQW34116.1"
gene 1415685..1416647
/locus_tag="B1761_07770"
CDS 1415685..1416647
/locus_tag="B1761_07770"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097866.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-oxoacyl-ACP synthase III"
/protein_id="AQW34117.1"
gene 1416711..1416935
/locus_tag="B1761_07775"
CDS 1416711..1416935
/locus_tag="B1761_07775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002938891.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acyl carrier protein"
/protein_id="AQW34118.1"
gene 1417041..1418006
/locus_tag="B1761_07780"
CDS 1417041..1418006
/locus_tag="B1761_07780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890043.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="2-nitropropane dioxygenase"
/protein_id="AQW34119.1"
gene 1418029..1418949
/locus_tag="B1761_07785"
CDS 1418029..1418949
/locus_tag="B1761_07785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885502.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="malonyl CoA-acyl carrier protein transacylase"
/protein_id="AQW34120.1"
gene 1418962..1419696
/locus_tag="B1761_07790"
CDS 1418962..1419696
/locus_tag="B1761_07790"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018163775.1"
/note="Derived by automated computational analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="beta-ketoacyl-ACP reductase"
/protein_id="AQW34121.1"
gene 1419758..1420990
/locus_tag="B1761_07795"
CDS 1419758..1420990
/locus_tag="B1761_07795"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225530.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="beta-ketoacyl-[acyl-carrier-protein] synthase
II"
/protein_id="AQW34122.1"
gene 1420994..1421482
/locus_tag="B1761_07800"
CDS 1420994..1421482
/locus_tag="B1761_07800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607998.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetyl-CoA carboxylase biotin carboxyl carrier
protein subunit"
/protein_id="AQW34123.1"
gene 1421479..1421904
/locus_tag="B1761_07805"
CDS 1421479..1421904
/locus_tag="B1761_07805"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885470.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="beta-hydroxyacyl-ACP dehydratase"
/protein_id="AQW34124.1"
gene 1422024..1423394
/locus_tag="B1761_07810"
CDS 1422024..1423394
/locus_tag="B1761_07810"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095475.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetyl-CoA carboxylase biotin carboxylase
subunit"
/protein_id="AQW34545.1"
gene 1423400..1424266
/locus_tag="B1761_07815"
CDS 1423400..1424266
/locus_tag="B1761_07815"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680785.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetyl-CoA carboxylase carboxyl transferase
subunit beta"
/protein_id="AQW34125.1"
gene 1424263..1425033
/locus_tag="B1761_07820"
CDS 1424263..1425033
/locus_tag="B1761_07820"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002281035.1"
/note="catalyzes the carboxylation of acetyl-CoA to
malonyl-CoA; forms a tetramer composed of two alpha (AccA)
and two beta (AccD) subunits; one of the two catalytic
subunits that can form the acetyl CoA carboxylase enzyme
together with a carrier protein; these proteins present a
shorter N-terminus; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetyl-CoA carboxylase carboxyl transferase
subunit alpha"
/protein_id="AQW34126.1"
gene complement(1425064..1425546)
/locus_tag="B1761_07825"
CDS complement(1425064..1425546)
/locus_tag="B1761_07825"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885585.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="S-ribosylhomocysteine lyase"
/protein_id="AQW34127.1"
gene 1425680..1425901
/locus_tag="B1761_07830"
/pseudo
CDS 1425680..1425901
/locus_tag="B1761_07830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949793.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="type I restriction endonuclease subunit S"
gene 1425904..1426032
/locus_tag="B1761_07835"
CDS 1425904..1426032
/locus_tag="B1761_07835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946042.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="restriction endonuclease"
/protein_id="AQW34128.1"
gene 1426073..1426753
/locus_tag="B1761_07840"
/pseudo
CDS 1426073..1426753
/locus_tag="B1761_07840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002339851.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="IS6 family transposase"
gene 1426915..1428294
/locus_tag="B1761_07845"
CDS 1426915..1428294
/locus_tag="B1761_07845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008794048.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamate decarboxylase"
/protein_id="AQW34129.1"
gene 1428352..1429764
/locus_tag="B1761_07850"
CDS 1428352..1429764
/locus_tag="B1761_07850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003841156.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid:proton antiporter"
/protein_id="AQW34546.1"
gene complement(1429943..1430338)
/locus_tag="B1761_07855"
CDS complement(1429943..1430338)
/locus_tag="B1761_07855"
/inference="COORDINATES: protein motif:HMM:PF01526.15"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34130.1"
gene 1430515..1431195
/locus_tag="B1761_07860"
CDS 1430515..1431195
/locus_tag="B1761_07860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002339851.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS6 family transposase"
/protein_id="AQW34131.1"
gene complement(1431214..1431468)
/locus_tag="B1761_07865"
CDS complement(1431214..1431468)
/locus_tag="B1761_07865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608006.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34547.1"
gene complement(1431554..1433083)
/locus_tag="B1761_07870"
CDS complement(1431554..1433083)
/locus_tag="B1761_07870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891408.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34132.1"
gene complement(1433189..1433524)
/locus_tag="B1761_07875"
/pseudo
CDS complement(1433189..1433524)
/locus_tag="B1761_07875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008535129.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(1433752..1435329)
/locus_tag="B1761_07880"
CDS complement(1433752..1435329)
/locus_tag="B1761_07880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948293.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW34133.1"
gene complement(1435331..1436625)
/locus_tag="B1761_07885"
/pseudo
CDS complement(1435331..1436625)
/locus_tag="B1761_07885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003060080.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="radical SAM/SPASM domain-containing protein"
gene 1437130..1437984
/locus_tag="B1761_07890"
CDS 1437130..1437984
/locus_tag="B1761_07890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948290.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MutR family transcriptional regulator"
/protein_id="AQW34134.1"
gene complement(1438195..1439046)
/locus_tag="B1761_07895"
/pseudo
CDS complement(1438195..1439046)
/locus_tag="B1761_07895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014572139.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(1439043..1439303)
/locus_tag="B1761_07900"
CDS complement(1439043..1439303)
/locus_tag="B1761_07900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019899500.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34135.1"
gene 1439799..1441406
/locus_tag="B1761_07905"
CDS 1439799..1441406
/locus_tag="B1761_07905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_007892954.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease Y"
/protein_id="AQW34136.1"
gene complement(1441735..1442532)
/locus_tag="B1761_07910"
/pseudo
CDS complement(1441735..1442532)
/locus_tag="B1761_07910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012560486.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 1442832..1443578
/locus_tag="B1761_07915"
CDS 1442832..1443578
/locus_tag="B1761_07915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009660338.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DeoR family transcriptional regulator"
/protein_id="AQW34137.1"
gene 1443575..1444486
/locus_tag="B1761_07920"
CDS 1443575..1444486
/locus_tag="B1761_07920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018163863.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="1-phosphofructokinase"
/protein_id="AQW34138.1"
gene 1444483..1446459
/locus_tag="B1761_07925"
CDS 1444483..1446459
/locus_tag="B1761_07925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015605103.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PTS fructose transporter subunit IIC"
/protein_id="AQW34139.1"
gene 1446607..1447959
/locus_tag="B1761_07930"
CDS 1446607..1447959
/locus_tag="B1761_07930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376406.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutathione-disulfide reductase"
/protein_id="AQW34140.1"
gene complement(1448060..1449316)
/locus_tag="B1761_07935"
CDS complement(1448060..1449316)
/locus_tag="B1761_07935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608016.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydrofolate synthase"
/protein_id="AQW34141.1"
gene complement(1449362..1449889)
/locus_tag="B1761_07940"
CDS complement(1449362..1449889)
/locus_tag="B1761_07940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727340.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34142.1"
gene 1449998..1451143
/locus_tag="B1761_07945"
CDS 1449998..1451143
/locus_tag="B1761_07945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013643215.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminotransferase V"
/protein_id="AQW34143.1"
gene 1451198..1452421
/locus_tag="B1761_07950"
CDS 1451198..1452421
/locus_tag="B1761_07950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680792.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA 4-thiouridine(8) synthase ThiI"
/protein_id="AQW34144.1"
gene 1452527..1454038
/locus_tag="B1761_07955"
CDS 1452527..1454038
/locus_tag="B1761_07955"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608019.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="accessory Sec system glycosyltransferase GtfA"
/protein_id="AQW34145.1"
gene 1454031..1455350
/locus_tag="B1761_07960"
CDS 1454031..1455350
/locus_tag="B1761_07960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680794.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="accessory Sec system glycosylation chaperone
GtfB"
/protein_id="AQW34146.1"
gene 1455355..1455890
/locus_tag="B1761_07965"
/pseudo
CDS 1455355..1455890
/locus_tag="B1761_07965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097832.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="GNAT family N-acetyltransferase"
gene 1456120..1456434
/locus_tag="B1761_07970"
CDS 1456120..1456434
/locus_tag="B1761_07970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018374562.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L21"
/protein_id="AQW34147.1"
gene 1456471..1456761
/locus_tag="B1761_07975"
CDS 1456471..1456761
/locus_tag="B1761_07975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376869.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L27"
/protein_id="AQW34148.1"
gene 1456820..1457515
/locus_tag="B1761_07980"
CDS 1456820..1457515
/locus_tag="B1761_07980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885575.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetyltransferase"
/protein_id="AQW34149.1"
gene 1457716..1458090
/locus_tag="B1761_07985"
CDS 1457716..1458090
/locus_tag="B1761_07985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885550.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW34150.1"
gene 1458092..1458933
/locus_tag="B1761_07990"
/pseudo
CDS 1458092..1458933
/locus_tag="B1761_07990"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885471.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="EDD domain protein"
gene 1458994..1459761
/locus_tag="B1761_07995"
CDS 1458994..1459761
/locus_tag="B1761_07995"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002262893.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="4-hydroxy-tetrahydrodipicolinate reductase"
/protein_id="AQW34151.1"
gene 1459758..1460966
/locus_tag="B1761_08000"
CDS 1459758..1460966
/locus_tag="B1761_08000"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949849.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CCA-adding enzyme"
/protein_id="AQW34152.1"
gene 1461044..1462924
/locus_tag="B1761_08005"
CDS 1461044..1462924
/locus_tag="B1761_08005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949851.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="antibiotic ABC transporter ATP-binding protein"
/protein_id="AQW34153.1"
gene complement(1463006..1463509)
/locus_tag="B1761_08010"
CDS complement(1463006..1463509)
/locus_tag="B1761_08010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949854.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34154.1"
gene complement(1463586..1464338)
/locus_tag="B1761_08015"
CDS complement(1463586..1464338)
/locus_tag="B1761_08015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680801.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA mismatch repair protein MutT"
/protein_id="AQW34155.1"
gene complement(1464402..1465508)
/locus_tag="B1761_08020"
CDS complement(1464402..1465508)
/locus_tag="B1761_08020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097817.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW34156.1"
gene 1465852..1467204
/locus_tag="B1761_08025"
CDS 1465852..1467204
/locus_tag="B1761_08025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018363527.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamate dehydrogenase"
/protein_id="AQW34157.1"
gene 1467463..1467873
/locus_tag="B1761_08030"
CDS 1467463..1467873
/locus_tag="B1761_08030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018363523.1"
/note="cleaves off formyl group from N-terminal methionine
residues of newly synthesized proteins; binds iron(2+);
Derived by automated computational analysis using gene
prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide deformylase"
/protein_id="AQW34158.1"
gene 1468064..1468507
/locus_tag="B1761_08035"
CDS 1468064..1468507
/locus_tag="B1761_08035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885568.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MarR family transcriptional regulator"
/protein_id="AQW34159.1"
gene 1468511..1470325
/locus_tag="B1761_08040"
CDS 1468511..1470325
/locus_tag="B1761_08040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004232101.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW34160.1"
gene 1470315..1472093
/locus_tag="B1761_08045"
CDS 1470315..1472093
/locus_tag="B1761_08045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886696.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter"
/protein_id="AQW34161.1"
gene 1472288..1472620
/locus_tag="B1761_08050"
CDS 1472288..1472620
/locus_tag="B1761_08050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680807.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GNAT family acetyltransferase"
/protein_id="AQW34548.1"
gene 1472643..1473807
/locus_tag="B1761_08055"
/pseudo
CDS 1472643..1473807
/locus_tag="B1761_08055"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095444.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="two-component sensor histidine kinase"
gene 1474043..1474780
/locus_tag="B1761_08060"
CDS 1474043..1474780
/locus_tag="B1761_08060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949867.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UMP kinase"
/protein_id="AQW34162.1"
gene 1474795..1475352
/locus_tag="B1761_08065"
CDS 1474795..1475352
/locus_tag="B1761_08065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015016748.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribosome-recycling factor"
/protein_id="AQW34163.1"
gene 1475443..1476300
/locus_tag="B1761_08070"
CDS 1475443..1476300
/locus_tag="B1761_08070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885476.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA-binding protein"
/protein_id="AQW34549.1"
gene 1476309..1476524
/locus_tag="B1761_08075"
CDS 1476309..1476524
/locus_tag="B1761_08075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017768673.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34164.1"
gene 1476765..1478216
/locus_tag="B1761_08080"
CDS 1476765..1478216
/locus_tag="B1761_08080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727351.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptigoglycan-binding protein LysM"
/protein_id="AQW34165.1"
gene 1478429..1478974
/locus_tag="B1761_08085"
CDS 1478429..1478974
/locus_tag="B1761_08085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608031.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34166.1"
gene 1479054..1480115
/locus_tag="B1761_08090"
CDS 1479054..1480115
/locus_tag="B1761_08090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002888785.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PhoH family protein"
/protein_id="AQW34167.1"
gene 1481325..1481738
/locus_tag="B1761_08095"
CDS 1481325..1481738
/locus_tag="B1761_08095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608035.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34168.1"
gene 1482187..1482423
/locus_tag="B1761_08100"
CDS 1482187..1482423
/locus_tag="B1761_08100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608037.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34169.1"
gene 1482420..1482827
/locus_tag="B1761_08105"
CDS 1482420..1482827
/locus_tag="B1761_08105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226920.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34170.1"
gene 1483021..1485024
/locus_tag="B1761_08110"
CDS 1483021..1485024
/locus_tag="B1761_08110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608038.1"
/note="methionine--tRNA ligase; MetRS; adds methionine to
tRNA(Met) with cleavage of ATP to AMP and diphosphate;
some MetRS enzymes form dimers depending on a C-terminal
domain that is also found in other proteins such as
Trbp111 in Aquifex aeolicus and the cold-shock protein
CsaA from Bacillus subtilis while others do not; four
subfamilies exist based on sequence motifs and zinc
content; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="methionine--tRNA ligase"
/protein_id="AQW34171.1"
gene complement(1485302..1486198)
/locus_tag="B1761_08115"
CDS complement(1485302..1486198)
/locus_tag="B1761_08115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095606.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LysR family transcriptional regulator"
/protein_id="AQW34172.1"
gene 1486691..1486894
/locus_tag="B1761_08120"
CDS 1486691..1486894
/locus_tag="B1761_08120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949893.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34173.1"
gene 1487496..1488455
/locus_tag="B1761_08125"
CDS 1487496..1488455
/locus_tag="B1761_08125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008533911.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="competence protein CoiA"
/protein_id="AQW34174.1"
gene 1488466..1490271
/locus_tag="B1761_08130"
CDS 1488466..1490271
/locus_tag="B1761_08130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097758.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="oligoendopeptidase F"
/protein_id="AQW34175.1"
gene 1490453..1491160
/locus_tag="B1761_08135"
CDS 1490453..1491160
/locus_tag="B1761_08135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633986.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="methyltransferase"
/protein_id="AQW34176.1"
gene 1491222..1492364
/locus_tag="B1761_08140"
CDS 1491222..1492364
/locus_tag="B1761_08140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095651.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="foldase PrsA"
/protein_id="AQW34177.1"
gene 1492700..1495318
/locus_tag="B1761_08145"
CDS 1492700..1495318
/locus_tag="B1761_08145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225574.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alanine--tRNA ligase"
/protein_id="AQW34178.1"
gene 1495486..1495701
/locus_tag="B1761_08150"
CDS 1495486..1495701
/locus_tag="B1761_08150"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621221.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34179.1"
gene 1495831..1496781
/locus_tag="B1761_08155"
CDS 1495831..1496781
/locus_tag="B1761_08155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949901.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lysozyme"
/protein_id="AQW34550.1"
gene 1496784..1496975
/locus_tag="B1761_08160"
CDS 1496784..1496975
/locus_tag="B1761_08160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952609.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="choline-binding protein"
/protein_id="AQW34180.1"
gene 1497275..1498234
/locus_tag="B1761_08165"
CDS 1497275..1498234
/locus_tag="B1761_08165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608048.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell wall protein"
/protein_id="AQW34181.1"
gene 1498367..1499155
/locus_tag="B1761_08170"
CDS 1498367..1499155
/locus_tag="B1761_08170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608049.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="carbon-nitrogen hydrolase"
/protein_id="AQW34182.1"
gene 1499165..1500346
/locus_tag="B1761_08175"
CDS 1499165..1500346
/locus_tag="B1761_08175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886066.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartate aminotransferase"
/protein_id="AQW34183.1"
gene 1500474..1501496
/locus_tag="B1761_08180"
CDS 1500474..1501496
/locus_tag="B1761_08180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013851615.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetyl-gamma-glutamyl-phosphate reductase"
/protein_id="AQW34184.1"
gene 1501525..1502718
/locus_tag="B1761_08185"
CDS 1501525..1502718
/locus_tag="B1761_08185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009853790.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional glutamate
N-acetyltransferase/amino-acid N-acetyltransferase"
/protein_id="AQW34185.1"
gene 1502746..1503483
/locus_tag="B1761_08190"
CDS 1502746..1503483
/locus_tag="B1761_08190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885993.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetylglutamate kinase"
/protein_id="AQW34186.1"
gene 1503487..1504617
/gene="argD"
/locus_tag="B1761_08195"
CDS 1503487..1504617
/gene="argD"
/locus_tag="B1761_08195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680827.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="acetylornithine transaminase"
/protein_id="AQW34187.1"
gene complement(1504658..1505536)
/locus_tag="B1761_08200"
CDS complement(1504658..1505536)
/locus_tag="B1761_08200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095602.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="polysaccharide deacetylase"
/protein_id="AQW34188.1"
gene 1505710..1506996
/locus_tag="B1761_08205"
CDS 1505710..1506996
/locus_tag="B1761_08205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014633999.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="homoserine dehydrogenase"
/protein_id="AQW34189.1"
gene 1507080..1507940
/locus_tag="B1761_08210"
CDS 1507080..1507940
/locus_tag="B1761_08210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680830.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="homoserine kinase"
/protein_id="AQW34190.1"
gene 1507933..1508817
/locus_tag="B1761_08215"
CDS 1507933..1508817
/locus_tag="B1761_08215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949926.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="EamA family transporter"
/protein_id="AQW34191.1"
gene 1508930..1509547
/locus_tag="B1761_08220"
CDS 1508930..1509547
/locus_tag="B1761_08220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003095663.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34192.1"
gene 1509682..1509885
/locus_tag="B1761_08225"
CDS 1509682..1509885
/locus_tag="B1761_08225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949930.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34193.1"
gene complement(1510070..1510330)
/locus_tag="B1761_08230"
CDS complement(1510070..1510330)
/locus_tag="B1761_08230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949932.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34194.1"
gene 1510329..1510919
/locus_tag="B1761_08235"
CDS 1510329..1510919
/locus_tag="B1761_08235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952615.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="flavin reductase"
/protein_id="AQW34195.1"
gene 1510894..1511470
/locus_tag="B1761_08240"
/pseudo
CDS 1510894..1511470
/locus_tag="B1761_08240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097739.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="GNAT family N-acetyltransferase"
gene 1511500..1514151
/locus_tag="B1761_08245"
CDS 1511500..1514151
/locus_tag="B1761_08245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002997072.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="valine--tRNA ligase"
/protein_id="AQW34196.1"
gene 1514328..1514525
/locus_tag="B1761_08250"
CDS 1514328..1514525
/locus_tag="B1761_08250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226934.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="F0F1 ATP synthase subunit C"
/protein_id="AQW34197.1"
gene 1514560..1515267
/locus_tag="B1761_08255"
CDS 1514560..1515267
/locus_tag="B1761_08255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885921.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="F0F1 ATP synthase subunit A"
/protein_id="AQW34198.1"
gene 1515288..1515785
/locus_tag="B1761_08260"
CDS 1515288..1515785
/locus_tag="B1761_08260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890203.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP synthase subunit B"
/protein_id="AQW34199.1"
gene 1515785..1516321
/locus_tag="B1761_08265"
CDS 1515785..1516321
/locus_tag="B1761_08265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949960.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP synthase subunit delta"
/protein_id="AQW34200.1"
gene 1516337..1517842
/locus_tag="B1761_08270"
CDS 1516337..1517842
/locus_tag="B1761_08270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011889023.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP synthase subunit alpha"
/protein_id="AQW34201.1"
gene 1517861..1518739
/locus_tag="B1761_08275"
CDS 1517861..1518739
/locus_tag="B1761_08275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886026.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP synthase subunit gamma"
/protein_id="AQW34202.1"
gene 1518816..1520222
/locus_tag="B1761_08280"
CDS 1518816..1520222
/locus_tag="B1761_08280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017770515.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP synthase subunit beta"
/protein_id="AQW34203.1"
gene 1520235..1520681
/locus_tag="B1761_08285"
CDS 1520235..1520681
/locus_tag="B1761_08285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621240.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP synthase epsilon chain"
/protein_id="AQW34204.1"
gene 1520935..1522215
/locus_tag="B1761_08290"
CDS 1520935..1522215
/locus_tag="B1761_08290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886004.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein FtsW"
/protein_id="AQW34551.1"
gene 1522453..1523649
/locus_tag="B1761_08295"
CDS 1522453..1523649
/locus_tag="B1761_08295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014335040.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="translation elongation factor Tu"
/protein_id="AQW34205.1"
gene 1523898..1524656
/locus_tag="B1761_08300"
CDS 1523898..1524656
/locus_tag="B1761_08300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000087908.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="triose-phosphate isomerase"
/protein_id="AQW34206.1"
gene 1524894..1525523
/locus_tag="B1761_08305"
CDS 1524894..1525523
/locus_tag="B1761_08305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608059.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thymidylate kinase"
/protein_id="AQW34207.1"
gene 1525532..1526407
/locus_tag="B1761_08310"
CDS 1525532..1526407
/locus_tag="B1761_08310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226940.1"
/note="catalyzes the DNA-template-directed extension of
the 3'-end of a DNA strand; the delta' subunit seems to
interact with the gamma subunit to transfer the beta
subunit on the DNA; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase III subunit delta'"
/protein_id="AQW34208.1"
gene 1526404..1527210
/locus_tag="B1761_08315"
CDS 1526404..1527210
/locus_tag="B1761_08315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887581.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="signal peptidase II"
/protein_id="AQW34209.1"
gene 1527197..1527517
/locus_tag="B1761_08320"
CDS 1527197..1527517
/locus_tag="B1761_08320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885932.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA replication intiation control protein YabA"
/protein_id="AQW34210.1"
gene 1527520..1528386
/locus_tag="B1761_08325"
CDS 1527520..1528386
/locus_tag="B1761_08325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008533974.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="rRNA (cytidine-2'-O-)-methyltransferase"
/protein_id="AQW34211.1"
gene 1528523..1529758
/locus_tag="B1761_08330"
CDS 1528523..1529758
/locus_tag="B1761_08330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019803800.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ammonia permease"
/protein_id="AQW34212.1"
gene 1529769..1530110
/locus_tag="B1761_08335"
CDS 1529769..1530110
/locus_tag="B1761_08335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621246.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW34213.1"
gene 1530208..1530864
/locus_tag="B1761_08340"
CDS 1530208..1530864
/locus_tag="B1761_08340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621247.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetylmuramoyl-L-alanine amidase"
/protein_id="AQW34214.1"
gene 1530887..1531708
/locus_tag="B1761_08345"
CDS 1530887..1531708
/locus_tag="B1761_08345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885966.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="haloacid dehalogenase"
/protein_id="AQW34215.1"
gene complement(1531727..1531849)
/locus_tag="B1761_08350"
CDS complement(1531727..1531849)
/locus_tag="B1761_08350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621249.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34216.1"
gene complement(1531908..1532234)
/locus_tag="B1761_08355"
CDS complement(1531908..1532234)
/locus_tag="B1761_08355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680843.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34217.1"
gene 1532247..1533009
/locus_tag="B1761_08360"
/pseudo
CDS 1532247..1533009
/locus_tag="B1761_08360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949986.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="sodium-dependent phosphate transporter"
gene 1533094..1534242
/locus_tag="B1761_08365"
CDS 1533094..1534242
/locus_tag="B1761_08365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608066.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetylglucosamine-6-phosphate deacetylase"
/protein_id="AQW34552.1"
gene 1534347..1535600
/locus_tag="B1761_08370"
/pseudo
CDS 1534347..1535600
/locus_tag="B1761_08370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886002.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1535872..1536789
/locus_tag="B1761_08375"
CDS 1535872..1536789
/locus_tag="B1761_08375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018163989.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycine--tRNA ligase subunit alpha"
/protein_id="AQW34218.1"
gene 1537073..1539109
/locus_tag="B1761_08380"
CDS 1537073..1539109
/locus_tag="B1761_08380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014712716.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycine--tRNA ligase subunit beta"
/protein_id="AQW34219.1"
gene 1539122..1539379
/locus_tag="B1761_08385"
CDS 1539122..1539379
/locus_tag="B1761_08385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002901318.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34220.1"
gene 1539550..1540941
/locus_tag="B1761_08390"
CDS 1539550..1540941
/locus_tag="B1761_08390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002949994.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid transporter"
/protein_id="AQW34221.1"
gene complement(1541012..1541647)
/locus_tag="B1761_08395"
CDS complement(1541012..1541647)
/locus_tag="B1761_08395"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225614.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nucleotidyltransferase"
/protein_id="AQW34222.1"
gene 1541951..1543858
/locus_tag="B1761_08400"
/pseudo
CDS 1541951..1543858
/locus_tag="B1761_08400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634028.1"
/note="phosphoenolpyruvate-dependent sugar
phosphotransferase system; catalyzes the phosphorylation
of incoming sugar substrates concomitant with their
translocation across the cell membrane; IIB is
phosphorylated by IIA and then transfers the phosphoryl
group to the sugar; IIC forms the translocation channel;
frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="PTS beta-glucoside transporter subunit IIABC"
gene complement(1543894..1544652)
/locus_tag="B1761_08405"
CDS complement(1543894..1544652)
/locus_tag="B1761_08405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226955.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidyl-prolyl cis-trans isomerase"
/protein_id="AQW34223.1"
gene complement(1544755..1545624)
/locus_tag="B1761_08410"
CDS complement(1544755..1545624)
/locus_tag="B1761_08410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681054.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW34224.1"
gene complement(1545639..1546325)
/locus_tag="B1761_08415"
CDS complement(1545639..1546325)
/locus_tag="B1761_08415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681053.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW34225.1"
gene 1546700..1546963
/locus_tag="B1761_08420"
CDS 1546700..1546963
/locus_tag="B1761_08420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950007.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34226.1"
gene 1547027..1547430
/locus_tag="B1761_08425"
/pseudo
CDS 1547027..1547430
/locus_tag="B1761_08425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680851.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1547427..1547904
/locus_tag="B1761_08430"
/pseudo
CDS 1547427..1547904
/locus_tag="B1761_08430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225621.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1548048..1548272
/locus_tag="B1761_08435"
CDS 1548048..1548272
/locus_tag="B1761_08435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621260.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34227.1"
gene 1548388..1549293
/locus_tag="B1761_08440"
CDS 1548388..1549293
/locus_tag="B1761_08440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019805079.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LysR family transcriptional regulator"
/protein_id="AQW34228.1"
gene 1549302..1549763
/locus_tag="B1761_08445"
CDS 1549302..1549763
/locus_tag="B1761_08445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890253.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="signal peptidase II"
/protein_id="AQW34229.1"
gene 1549747..1550637
/locus_tag="B1761_08450"
CDS 1549747..1550637
/locus_tag="B1761_08450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621261.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pseudouridine synthase"
/protein_id="AQW34230.1"
gene 1550864..1551385
/locus_tag="B1761_08455"
CDS 1550864..1551385
/locus_tag="B1761_08455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002944491.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional pyrimidine operon transcriptional
regulator/uracil phosphoribosyltransferase"
/protein_id="AQW34231.1"
gene 1551733..1553010
/locus_tag="B1761_08460"
CDS 1551733..1553010
/locus_tag="B1761_08460"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889465.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="uracil permease"
/protein_id="AQW34232.1"
gene 1553035..1553961
/locus_tag="B1761_08465"
CDS 1553035..1553961
/locus_tag="B1761_08465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004232204.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartate carbamoyltransferase"
/protein_id="AQW34233.1"
gene 1554114..1555202
/locus_tag="B1761_08470"
CDS 1554114..1555202
/locus_tag="B1761_08470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950028.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="carbamoyl phosphate synthase small subunit"
/protein_id="AQW34234.1"
gene 1555547..1558726
/locus_tag="B1761_08475"
CDS 1555547..1558726
/locus_tag="B1761_08475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019803305.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="carbamoyl-phosphate synthase large chain"
/protein_id="AQW34235.1"
gene 1558846..1559604
/locus_tag="B1761_08480"
CDS 1558846..1559604
/locus_tag="B1761_08480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947274.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SAM-dependent methyltransferase"
/protein_id="AQW34236.1"
gene 1559871..1560228
/locus_tag="B1761_08485"
/pseudo
CDS 1559871..1560228
/locus_tag="B1761_08485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621264.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1560468..1560713
/locus_tag="B1761_08490"
CDS 1560468..1560713
/locus_tag="B1761_08490"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="ABC transporter substrate-binding protein"
/protein_id="AQW34237.1"
gene 1560775..1561026
/locus_tag="B1761_08495"
CDS 1560775..1561026
/locus_tag="B1761_08495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608077.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter substrate-binding protein"
/protein_id="AQW34238.1"
gene 1561027..1561236
/locus_tag="B1761_08500"
CDS 1561027..1561236
/locus_tag="B1761_08500"
/inference="COORDINATES: ab initio prediction:GeneMarkS+"
/note="Derived by automated computational analysis using
gene prediction method: GeneMarkS+."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34239.1"
gene 1561293..1561531
/locus_tag="B1761_08505"
/pseudo
CDS 1561293..1561531
/locus_tag="B1761_08505"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947292.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="macrolide ABC transporter"
gene 1561540..1561743
/locus_tag="B1761_08510"
CDS 1561540..1561743
/locus_tag="B1761_08510"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608080.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34553.1"
gene 1562034..1562537
/locus_tag="B1761_08515"
CDS 1562034..1562537
/locus_tag="B1761_08515"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018376918.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L10"
/protein_id="AQW34240.1"
gene 1562612..1562980
/locus_tag="B1761_08520"
CDS 1562612..1562980
/locus_tag="B1761_08520"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018371186.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L7/L12"
/protein_id="AQW34241.1"
gene complement(1563355..1564530)
/locus_tag="B1761_08525"
CDS complement(1563355..1564530)
/locus_tag="B1761_08525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011675534.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS256 family transposase"
/protein_id="AQW34242.1"
gene 1565557..1567293
/locus_tag="B1761_08530"
CDS 1565557..1567293
/locus_tag="B1761_08530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889122.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW34243.1"
gene 1567306..1569093
/locus_tag="B1761_08535"
CDS 1567306..1569093
/locus_tag="B1761_08535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680872.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW34244.1"
gene complement(1569191..1570234)
/locus_tag="B1761_08540"
CDS complement(1569191..1570234)
/locus_tag="B1761_08540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226968.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="tRNA preQ1(34) S-adenosylmethionine
ribosyltransferase-isomerase QueA"
/protein_id="AQW34245.1"
gene 1570384..1571085
/locus_tag="B1761_08545"
CDS 1570384..1571085
/locus_tag="B1761_08545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608085.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glucosamine-6-phosphate deaminase"
/protein_id="AQW34246.1"
gene complement(1571251..1572546)
/locus_tag="B1761_08550"
CDS complement(1571251..1572546)
/locus_tag="B1761_08550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680875.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidine kinase"
/protein_id="AQW34247.1"
gene complement(1572546..1573256)
/locus_tag="B1761_08555"
CDS complement(1572546..1573256)
/locus_tag="B1761_08555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950056.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding response regulator"
/protein_id="AQW34248.1"
gene 1573589..1574659
/locus_tag="B1761_08560"
CDS 1573589..1574659
/locus_tag="B1761_08560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727367.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="molybdopterin biosynthesis protein MoeB"
/protein_id="AQW34249.1"
gene 1574656..1575567
/locus_tag="B1761_08565"
CDS 1574656..1575567
/locus_tag="B1761_08565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197224.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter ATP-binding protein"
/protein_id="AQW34250.1"
gene 1575569..1576291
/locus_tag="B1761_08570"
CDS 1575569..1576291
/locus_tag="B1761_08570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534032.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW34251.1"
gene 1576480..1577463
/locus_tag="B1761_08575"
CDS 1576480..1577463
/locus_tag="B1761_08575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727368.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34252.1"
gene 1577644..1577841
/locus_tag="B1761_08580"
CDS 1577644..1577841
/locus_tag="B1761_08580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950082.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW34253.1"
gene 1577858..1578349
/locus_tag="B1761_08585"
CDS 1577858..1578349
/locus_tag="B1761_08585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950083.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34254.1"
gene 1578428..1579198
/locus_tag="B1761_08590"
CDS 1578428..1579198
/locus_tag="B1761_08590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608090.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphorylase"
/protein_id="AQW34255.1"
gene 1579292..1579975
/locus_tag="B1761_08595"
CDS 1579292..1579975
/locus_tag="B1761_08595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890291.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34554.1"
gene 1580055..1580774
/locus_tag="B1761_08600"
CDS 1580055..1580774
/locus_tag="B1761_08600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182981.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="16S rRNA pseudouridine(516) synthase"
/protein_id="AQW34256.1"
gene 1581010..1582155
/locus_tag="B1761_08605"
CDS 1581010..1582155
/locus_tag="B1761_08605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608093.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase M20"
/protein_id="AQW34257.1"
gene 1582588..1582725
/locus_tag="B1761_08610"
CDS 1582588..1582725
/locus_tag="B1761_08610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225652.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alanine dehydrogenase"
/protein_id="AQW34258.1"
gene 1582700..1583038
/locus_tag="B1761_08615"
CDS 1582700..1583038
/locus_tag="B1761_08615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727370.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alanine dehydrogenase"
/protein_id="AQW34259.1"
gene 1583695..1585011
/locus_tag="B1761_08620"
CDS 1583695..1585011
/locus_tag="B1761_08620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002902738.1"
/note="Involved in disulfide oxidoreductase activity and
electron transport; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="pyridine nucleotide-disulfide oxidoreductase"
/protein_id="AQW34260.1"
gene complement(1585280..1585843)
/locus_tag="B1761_08625"
CDS complement(1585280..1585843)
/locus_tag="B1761_08625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097657.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34261.1"
gene 1586106..1586984
/locus_tag="B1761_08630"
CDS 1586106..1586984
/locus_tag="B1761_08630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002889105.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="mevalonate kinase"
/protein_id="AQW34262.1"
gene 1586966..1587910
/locus_tag="B1761_08635"
CDS 1586966..1587910
/locus_tag="B1761_08635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886079.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="diphosphomevalonate decarboxylase"
/protein_id="AQW34263.1"
gene 1587903..1588898
/locus_tag="B1761_08640"
CDS 1587903..1588898
/locus_tag="B1761_08640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680888.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphomevalonate kinase"
/protein_id="AQW34264.1"
gene 1588948..1589955
/locus_tag="B1761_08645"
CDS 1588948..1589955
/locus_tag="B1761_08645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608100.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type 2 isopentenyl-diphosphate Delta-isomerase"
/protein_id="AQW34265.1"
gene 1590505..1591887
/locus_tag="B1761_08650"
CDS 1590505..1591887
/locus_tag="B1761_08650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608101.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional N-acetylglucosamine-1-phosphate
uridyltransferase/glucosamine-1-phosphate
acetyltransferase"
/protein_id="AQW34266.1"
gene 1591963..1592511
/locus_tag="B1761_08655"
CDS 1591963..1592511
/locus_tag="B1761_08655"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097648.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ADP-ribose pyrophosphatase"
/protein_id="AQW34267.1"
gene 1592515..1592775
/locus_tag="B1761_08660"
CDS 1592515..1592775
/locus_tag="B1761_08660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950108.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34268.1"
gene 1592843..1593535
/locus_tag="B1761_08665"
CDS 1592843..1593535
/locus_tag="B1761_08665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621328.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="5'-methylthioadenosine/S-adenosylhomocysteine
nucleosidase"
/protein_id="AQW34269.1"
gene 1594373..1594843
/locus_tag="B1761_08670"
CDS 1594373..1594843
/locus_tag="B1761_08670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727376.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase"
/protein_id="AQW34270.1"
gene 1594974..1595264
/locus_tag="B1761_08675"
CDS 1594974..1595264
/locus_tag="B1761_08675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225661.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LPXTG cell wall anchor domain-containing
protein"
/protein_id="AQW34555.1"
gene 1595389..1596393
/locus_tag="B1761_08680"
CDS 1595389..1596393
/locus_tag="B1761_08680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608104.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycosyl transferase family 1"
/protein_id="AQW34271.1"
gene 1596394..1597716
/locus_tag="B1761_08685"
CDS 1596394..1597716
/locus_tag="B1761_08685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950115.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="1,2-diacylglycerol 3-glucosyltransferase"
/protein_id="AQW34272.1"
gene 1598048..1598273
/locus_tag="B1761_08690"
/pseudo
CDS 1598048..1598273
/locus_tag="B1761_08690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002944050.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1598427..1600373
/locus_tag="B1761_08695"
CDS 1598427..1600373
/locus_tag="B1761_08695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182963.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="threonine--tRNA ligase"
/protein_id="AQW34273.1"
gene 1600423..1601363
/locus_tag="B1761_08700"
/pseudo
CDS 1600423..1601363
/locus_tag="B1761_08700"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950124.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="alpha/beta hydrolase"
gene 1601383..1602249
/locus_tag="B1761_08705"
CDS 1601383..1602249
/locus_tag="B1761_08705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608107.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34274.1"
gene 1602261..1602443
/locus_tag="B1761_08710"
CDS 1602261..1602443
/locus_tag="B1761_08710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950127.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34275.1"
gene complement(1602535..1602720)
/locus_tag="B1761_08715"
CDS complement(1602535..1602720)
/locus_tag="B1761_08715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886147.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="PspC family transcriptional regulator"
/protein_id="AQW34556.1"
gene complement(1602754..1603431)
/locus_tag="B1761_08720"
CDS complement(1602754..1603431)
/locus_tag="B1761_08720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952667.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hemolysin III"
/protein_id="AQW34276.1"
gene complement(1603424..1603872)
/locus_tag="B1761_08725"
/pseudo
CDS complement(1603424..1603872)
/locus_tag="B1761_08725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885964.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene complement(1604044..1605315)
/locus_tag="B1761_08730"
CDS complement(1604044..1605315)
/locus_tag="B1761_08730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950141.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hydroxymethylglutaryl-CoA reductase,
degradative"
/protein_id="AQW34277.1"
gene complement(1605308..1606483)
/locus_tag="B1761_08735"
CDS complement(1605308..1606483)
/locus_tag="B1761_08735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950144.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hydroxymethylglutaryl-CoA synthase"
/protein_id="AQW34278.1"
gene 1606805..1607665
/locus_tag="B1761_08740"
CDS 1606805..1607665
/locus_tag="B1761_08740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003011065.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thymidylate synthase"
/protein_id="AQW34279.1"
gene 1607773..1608276
/locus_tag="B1761_08745"
CDS 1607773..1608276
/locus_tag="B1761_08745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225671.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dihydrofolate reductase"
/protein_id="AQW34280.1"
gene 1608469..1609695
/locus_tag="B1761_08750"
CDS 1608469..1609695
/locus_tag="B1761_08750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_019802692.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-dependent Clp protease ATP-binding subunit
ClpX"
/protein_id="AQW34281.1"
gene 1609705..1610304
/gene="engB"
/locus_tag="B1761_08755"
CDS 1609705..1610304
/gene="engB"
/locus_tag="B1761_08755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950154.1"
/note="binds guanine nucleotides; in Escherichia coli
depletion results in defective cell division and
filamentation; in Bacillus subtilis this gene is
essential; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTP-binding protein"
/protein_id="AQW34282.1"
gene 1610434..1611810
/locus_tag="B1761_08760"
CDS 1610434..1611810
/locus_tag="B1761_08760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094138.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="amino acid permease"
/protein_id="AQW34283.1"
gene 1611822..1612772
/locus_tag="B1761_08765"
CDS 1611822..1612772
/locus_tag="B1761_08765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950163.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="homocysteine S-methyltransferase"
/protein_id="AQW34284.1"
gene 1612885..1613139
/locus_tag="B1761_08770"
CDS 1612885..1613139
/locus_tag="B1761_08770"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182954.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aldose epimerase"
/protein_id="AQW34285.1"
gene 1613211..1613570
/locus_tag="B1761_08775"
CDS 1613211..1613570
/locus_tag="B1761_08775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950165.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34286.1"
gene complement(1613684..1614325)
/locus_tag="B1761_08780"
CDS complement(1613684..1614325)
/locus_tag="B1761_08780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002962188.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycerol-3-phosphate acyltransferase"
/protein_id="AQW34287.1"
gene 1614463..1616412
/locus_tag="B1761_08785"
CDS 1614463..1616412
/locus_tag="B1761_08785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015632049.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA topoisomerase IV subunit B"
/protein_id="AQW34288.1"
gene 1617049..1619505
/locus_tag="B1761_08790"
CDS 1617049..1619505
/locus_tag="B1761_08790"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608111.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA topoisomerase IV subunit A"
/protein_id="AQW34289.1"
gene 1619669..1620691
/locus_tag="B1761_08795"
CDS 1619669..1620691
/locus_tag="B1761_08795"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012961903.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="branched chain amino acid aminotransferase"
/protein_id="AQW34290.1"
gene 1620830..1621039
/locus_tag="B1761_08800"
CDS 1620830..1621039
/locus_tag="B1761_08800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634116.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34557.1"
gene 1621100..1621180
/locus_tag="B1761_08805"
tRNA 1621100..1621180
/locus_tag="B1761_08805"
/product="tRNA-Tyr"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1621134..1621136,aa:Tyr,seq:gta)
gene 1621249..1621323
/locus_tag="B1761_08810"
tRNA 1621249..1621323
/locus_tag="B1761_08810"
/product="tRNA-Gln"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1621281..1621283,aa:Gln,seq:ttg)
gene 1621441..1622643
/locus_tag="B1761_08815"
CDS 1621441..1622643
/locus_tag="B1761_08815"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015017068.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S1"
/protein_id="AQW34291.1"
gene 1622712..1622783
/locus_tag="B1761_08820"
tRNA 1622712..1622783
/locus_tag="B1761_08820"
/product="tRNA-Arg"
/inference="COORDINATES: profile:tRNAscan-SE:1.23"
/anticodon=(pos:1622745..1622747,aa:Arg,seq:ccg)
gene 1623078..1623427
/gene="ssrA"
/locus_tag="B1761_08825"
tmRNA 1623078..1623427
/gene="ssrA"
/locus_tag="B1761_08825"
/product="transfer-messenger RNA"
/inference="COORDINATES: nucleotide
motif:Rfam:12.0:RF00023"
/inference="COORDINATES: profile:INFERNAL:1.1.1"
/note="Derived by automated computational analysis using
gene prediction method: cmsearch."
/db_xref="RFAM:RF00023"
gene 1623471..1623869
/locus_tag="B1761_08830"
CDS 1623471..1623869
/locus_tag="B1761_08830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225679.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34292.1"
gene 1623827..1624093
/locus_tag="B1761_08835"
CDS 1623827..1624093
/locus_tag="B1761_08835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226996.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34293.1"
gene 1624305..1624848
/locus_tag="B1761_08840"
/pseudo
CDS 1624305..1624848
/locus_tag="B1761_08840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621342.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1624826..1626061
/locus_tag="B1761_08845"
CDS 1624826..1626061
/locus_tag="B1761_08845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950192.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidoglycan branched peptide synthesis
protein"
/protein_id="AQW34294.1"
gene 1626160..1627122
/locus_tag="B1761_08850"
/pseudo
CDS 1626160..1627122
/locus_tag="B1761_08850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534090.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="NAD(P)-dependent oxidoreductase"
gene complement(1627163..1627465)
/locus_tag="B1761_08855"
CDS complement(1627163..1627465)
/locus_tag="B1761_08855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608115.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribose-5-phosphate isomerase"
/protein_id="AQW34295.1"
gene complement(1627475..1627933)
/locus_tag="B1761_08860"
CDS complement(1627475..1627933)
/locus_tag="B1761_08860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680917.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NUDIX hydrolase"
/protein_id="AQW34296.1"
gene complement(1628076..1630334)
/locus_tag="B1761_08865"
CDS complement(1628076..1630334)
/locus_tag="B1761_08865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727380.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ATP-dependent Clp protease ATP-binding subunit"
/protein_id="AQW34297.1"
gene 1630575..1631555
/locus_tag="B1761_08870"
CDS 1630575..1631555
/locus_tag="B1761_08870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093840.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ornithine carbamoyltransferase"
/protein_id="AQW34298.1"
gene 1631624..1631854
/locus_tag="B1761_08875"
CDS 1631624..1631854
/locus_tag="B1761_08875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003105222.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34299.1"
gene 1632126..1632806
/locus_tag="B1761_08880"
CDS 1632126..1632806 /locus_tag="B1761_08880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890385.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine ABC transporter permease"
/protein_id="AQW34300.1"
gene 1632806..1633540
/gene="glnQ"
/locus_tag="B1761_08885"
CDS 1632806..1633540
/gene="glnQ"
/locus_tag="B1761_08885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_017769699.1"
/note="similar to ATP-binding component of ABC
transporters; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutamine ABC transporter ATP-binding protein"
/protein_id="AQW34301.1"
gene 1633714..1634190
/locus_tag="B1761_08890"
CDS 1633714..1634190
/locus_tag="B1761_08890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946717.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ferrous iron transport protein A"
/protein_id="AQW34302.1"
gene 1634187..1636325
/locus_tag="B1761_08895"
CDS 1634187..1636325
/locus_tag="B1761_08895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227002.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ferrous iron transport protein B"
/protein_id="AQW34303.1"
gene 1636337..1636477
/locus_tag="B1761_08900"
CDS 1636337..1636477
/locus_tag="B1761_08900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621348.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34304.1"
gene 1636589..1637164
/locus_tag="B1761_08905"
CDS 1636589..1637164
/locus_tag="B1761_08905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680922.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dTDP-4-dehydrorhamnose 3,5-epimerase"
/protein_id="AQW34305.1"
gene 1637283..1637396
/locus_tag="B1761_08910"
/pseudo
CDS 1637283..1637396
/locus_tag="B1761_08910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948996.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="capsular biosynthesis protein CpsL"
gene 1637639..1637926
/locus_tag="B1761_08915"
/pseudo
CDS 1637639..1637926
/locus_tag="B1761_08915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_012560528.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
gene 1638122..1638334
/locus_tag="B1761_08920"
CDS 1638122..1638334
/locus_tag="B1761_08920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680924.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lysophospholipase"
/protein_id="AQW34306.1"
gene 1638582..1638773
/locus_tag="B1761_08925"
CDS 1638582..1638773
/locus_tag="B1761_08925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950214.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34307.1"
gene 1638946..1639800
/locus_tag="B1761_08930"
CDS 1638946..1639800
/locus_tag="B1761_08930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_041826990.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional 5,10-methylene-tetrahydrofolate
dehydrogenase/5,10-methylene-tetrahydrofolate
cyclohydrolase"
/protein_id="AQW34308.1"
gene 1639804..1640640
/locus_tag="B1761_08935"
CDS 1639804..1640640
/locus_tag="B1761_08935"
/inference="COORDINATES: similar to AA
sequence:SwissProt:P96051.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NAD(P)H-hydrate dehydratase"
/protein_id="AQW34309.1"
gene 1640762..1642876
/locus_tag="B1761_08940"
CDS 1640762..1642876
/locus_tag="B1761_08940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621352.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="penicillin-binding protein"
/protein_id="AQW34310.1"
gene 1642986..1643582
/locus_tag="B1761_08945"
CDS 1642986..1643582
/locus_tag="B1761_08945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002896112.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="recombination protein RecR"
/protein_id="AQW34311.1"
gene 1643723..1644094
/locus_tag="B1761_08950"
CDS 1643723..1644094
/locus_tag="B1761_08950"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621353.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcription antiterminator BglG"
/protein_id="AQW34312.1"
gene 1644070..1644168
/locus_tag="B1761_08955"
CDS 1644070..1644168
/locus_tag="B1761_08955"
/inference="COORDINATES: protein motif:HMM:PF00874.18"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34558.1"
gene 1644202..1644519
/locus_tag="B1761_08960"
CDS 1644202..1644519
/locus_tag="B1761_08960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950223.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcription antiterminator BglG"
/protein_id="AQW34313.1"
gene 1644738..1645235
/locus_tag="B1761_08965"
CDS 1644738..1645235
/locus_tag="B1761_08965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018380869.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="endoribonuclease YbeY"
/protein_id="AQW34314.1"
gene 1645216..1645620
/locus_tag="B1761_08970"
CDS 1645216..1645620
/locus_tag="B1761_08970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946201.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP kinase"
/protein_id="AQW34315.1"
gene 1645639..1646538
/locus_tag="B1761_08975"
CDS 1645639..1646538
/locus_tag="B1761_08975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002894867.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTPase Era"
/protein_id="AQW34316.1"
gene 1646585..1647406
/locus_tag="B1761_08980"
CDS 1646585..1647406
/locus_tag="B1761_08980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227010.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="formamidopyrimidine-DNA glycosylase"
/protein_id="AQW34317.1"
gene 1647403..1647996
/locus_tag="B1761_08985"
CDS 1647403..1647996
/locus_tag="B1761_08985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_041826991.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dephospho-CoA kinase"
/protein_id="AQW34318.1"
gene 1648047..1649270
/locus_tag="B1761_08990"
CDS 1648047..1649270
/locus_tag="B1761_08990"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534106.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MFS transporter"
/protein_id="AQW34319.1"
gene 1649260..1649406
/locus_tag="B1761_08995"
CDS 1649260..1649406
/locus_tag="B1761_08995"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_016356085.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L33"
/protein_id="AQW34320.1"
gene 1649451..1649687
/locus_tag="B1761_09000"
CDS 1649451..1649687
/locus_tag="B1761_09000"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018374825.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="preprotein translocase subunit SecG"
/protein_id="AQW34321.1"
gene 1649746..1652199
/locus_tag="B1761_09005"
CDS 1649746..1652199
/locus_tag="B1761_09005"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634132.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ribonuclease R"
/protein_id="AQW34322.1"
gene 1652221..1652685
/locus_tag="B1761_09010"
CDS 1652221..1652685
/locus_tag="B1761_09010"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534110.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SsrA-binding protein"
/protein_id="AQW34323.1"
gene 1652839..1654245
/locus_tag="B1761_09015"
CDS 1652839..1654245
/locus_tag="B1761_09015"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227013.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidylprolyl isomerase"
/protein_id="AQW34324.1"
gene 1654247..1654612
/locus_tag="B1761_09020"
CDS 1654247..1654612
/locus_tag="B1761_09020"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621358.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34325.1"
gene complement(1654715..1655800)
/locus_tag="B1761_09025"
CDS complement(1654715..1655800)
/locus_tag="B1761_09025"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097563.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase M24 family protein"
/protein_id="AQW34326.1"
gene 1656114..1657115
/locus_tag="B1761_09030"
CDS 1656114..1657115
/locus_tag="B1761_09030"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197422.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="catabolite control protein A"
/protein_id="AQW34327.1"
gene 1657174..1657371
/locus_tag="B1761_09035"
CDS 1657174..1657371
/locus_tag="B1761_09035"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950246.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MmcQ family protein"
/protein_id="AQW34328.1"
gene 1657477..1658241
/locus_tag="B1761_09040"
/pseudo
CDS 1657477..1658241
/locus_tag="B1761_09040"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197425.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1658254..1659369
/locus_tag="B1761_09045"
CDS 1658254..1659369
/locus_tag="B1761_09045"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950249.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycerate kinase"
/protein_id="AQW34329.1"
gene complement(1659416..1659871)
/locus_tag="B1761_09050"
CDS complement(1659416..1659871)
/locus_tag="B1761_09050"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950250.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glycogen synthase"
/protein_id="AQW34330.1"
gene 1660080..1661384
/locus_tag="B1761_09055"
CDS 1660080..1661384
/locus_tag="B1761_09055"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002985288.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="enolase"
/protein_id="AQW34331.1"
gene complement(1661536..1661721)
/locus_tag="B1761_09060"
CDS complement(1661536..1661721)
/locus_tag="B1761_09060"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014713608.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34332.1"
gene complement(1661883..1664069)
/locus_tag="B1761_09065"
CDS complement(1661883..1664069)
/locus_tag="B1761_09065"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621364.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alkaline phosphatase"
/protein_id="AQW34333.1"
gene 1664231..1665394
/locus_tag="B1761_09070"
CDS 1664231..1665394
/locus_tag="B1761_09070"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950251.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SAM-dependent methyltransferase"
/protein_id="AQW34334.1"
gene 1665391..1666068
/gene="aroD"
/locus_tag="B1761_09075"
CDS 1665391..1666068
/gene="aroD"
/locus_tag="B1761_09075"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890457.1"
/note="catalyzes the dehydration of 3-dehydroquinate to
form 3-dehydroshikimate in aromatic amino acid
biosynthesis; Derived by automated computational analysis
using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-dehydroquinase"
/protein_id="AQW34335.1"
gene 1666058..1666915
/locus_tag="B1761_09080"
CDS 1666058..1666915
/locus_tag="B1761_09080"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947239.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="shikimate dehydrogenase"
/protein_id="AQW34336.1"
gene 1666928..1667995
/locus_tag="B1761_09085"
CDS 1666928..1667995
/locus_tag="B1761_09085"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006532527.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-dehydroquinate synthase"
/protein_id="AQW34337.1"
gene 1667996..1669162
/locus_tag="B1761_09090"
CDS 1667996..1669162
/locus_tag="B1761_09090"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002997861.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="chorismate synthase"
/protein_id="AQW34338.1"
gene 1669192..1670298
/locus_tag="B1761_09095"
CDS 1669192..1670298
/locus_tag="B1761_09095"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534131.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="prephenate dehydrogenase"
/protein_id="AQW34339.1"
gene 1670308..1670646
/locus_tag="B1761_09100"
CDS 1670308..1670646
/locus_tag="B1761_09100"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002947244.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34340.1"
gene 1670702..1671649
/locus_tag="B1761_09105"
CDS 1670702..1671649
/locus_tag="B1761_09105"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950260.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="L-lactate dehydrogenase"
/protein_id="AQW34341.1"
gene 1671733..1673016
/locus_tag="B1761_09110"
CDS 1671733..1673016
/locus_tag="B1761_09110"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950263.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="3-phosphoshikimate 1-carboxyvinyltransferase"
/protein_id="AQW34342.1"
gene 1673009..1673500
/locus_tag="B1761_09115"
CDS 1673009..1673500
/locus_tag="B1761_09115"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634149.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="shikimate kinase"
/protein_id="AQW34343.1"
gene 1673491..1674315
/locus_tag="B1761_09120"
CDS 1673491..1674315
/locus_tag="B1761_09120"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950266.1"
/note="catalyzes the formation of phenylpyruvate from
prephenate in phenylalanine biosynthesis; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="prephenate dehydratase"
/protein_id="AQW34344.1"
gene 1674327..1675757
/locus_tag="B1761_09125"
CDS 1674327..1675757
/locus_tag="B1761_09125"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680948.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="LytR family transcriptional regulator"
/protein_id="AQW34345.1"
gene complement(1675743..1676709)
/locus_tag="B1761_09130"
/pseudo
CDS complement(1675743..1676709)
/locus_tag="B1761_09130"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621374.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ethanolamine utilization protein EutJ"
gene complement(1676726..1677790)
/locus_tag="B1761_09135"
CDS complement(1676726..1677790)
/locus_tag="B1761_09135"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950304.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dehydrogenase"
/protein_id="AQW34346.1"
gene complement(1677830..1678378)
/locus_tag="B1761_09140"
CDS complement(1677830..1678378)
/locus_tag="B1761_09140"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680951.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="alkylhydroperoxidase"
/protein_id="AQW34347.1"
gene 1678594..1679955
/locus_tag="B1761_09145"
CDS 1678594..1679955
/locus_tag="B1761_09145"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946839.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="23S rRNA (uracil-5-)-methyltransferase RumA"
/protein_id="AQW34348.1"
gene 1680234..1680521
/locus_tag="B1761_09150"
CDS 1680234..1680521
/locus_tag="B1761_09150"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680953.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34349.1"
gene 1680518..1680994
/locus_tag="B1761_09155"
CDS 1680518..1680994
/locus_tag="B1761_09155"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680954.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34350.1"
gene 1681162..1681383
/locus_tag="B1761_09160"
CDS 1681162..1681383
/locus_tag="B1761_09160"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950309.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW34351.1"
gene 1681383..1681841
/locus_tag="B1761_09165"
CDS 1681383..1681841
/locus_tag="B1761_09165"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227026.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="adenine methyltransferase"
/protein_id="AQW34559.1"
gene complement(1682008..1682265)
/locus_tag="B1761_09170"
CDS complement(1682008..1682265)
/locus_tag="B1761_09170"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621378.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34352.1"
gene 1682435..1683049
/locus_tag="B1761_09175"
CDS 1682435..1683049
/locus_tag="B1761_09175"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727387.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF2140 domain-containing protein"
/protein_id="AQW34353.1"
gene 1683303..1686668
/locus_tag="B1761_09180"
CDS 1683303..1686668
/locus_tag="B1761_09180"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608134.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type II CRISPR RNA-guided endonuclease Cas9"
/protein_id="AQW34354.1"
gene 1686846..1687757
/locus_tag="B1761_09185"
CDS 1686846..1687757
/locus_tag="B1761_09185"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950323.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="subtype II CRISPR-associated endonuclease Cas1"
/protein_id="AQW34355.1"
gene 1687759..1688082
/locus_tag="B1761_09190"
CDS 1687759..1688082
/locus_tag="B1761_09190"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946754.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CRISPR-associated endonuclease Cas2"
/protein_id="AQW34356.1"
gene 1688079..1689131
/locus_tag="B1761_09195"
CDS 1688079..1689131
/locus_tag="B1761_09195"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225728.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34357.1"
repeat_region 1689194..1691603
/inference="COORDINATES: alignment:crt:1.2"
/inference="COORDINATES: alignment:pilercr:v1.02"
/rpt_family="CRISPR"
/rpt_type=direct
/rpt_unit_range=1689194..1689229
/rpt_unit_seq="gtttttgtactctcaagatttaagtaactgtacaac"
gene complement(1691645..1692460)
/locus_tag="B1761_09200"
CDS complement(1691645..1692460)
/locus_tag="B1761_09200"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952695.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="TIGR03943 family protein"
/protein_id="AQW34358.1"
gene complement(1692460..1693362)
/locus_tag="B1761_09205"
CDS complement(1692460..1693362)
/locus_tag="B1761_09205"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608141.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34359.1"
gene 1693726..1695858
/locus_tag="B1761_09210"
CDS 1693726..1695858
/locus_tag="B1761_09210"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003093657.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA-binding transcriptional accessory protein"
/protein_id="AQW34360.1"
gene 1695845..1696285
/locus_tag="B1761_09215"
CDS 1695845..1696285
/locus_tag="B1761_09215"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097487.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SprT family protein"
/protein_id="AQW34361.1"
gene 1696351..1696614
/locus_tag="B1761_09220"
CDS 1696351..1696614
/locus_tag="B1761_09220"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225732.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34362.1"
gene 1696745..1697674
/locus_tag="B1761_09225"
CDS 1696745..1697674
/locus_tag="B1761_09225"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634203.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HPr kinase/phosphorylase"
/protein_id="AQW34363.1"
gene 1697674..1698465
/locus_tag="B1761_09230"
CDS 1697674..1698465
/locus_tag="B1761_09230"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534216.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="prolipoprotein diacylglyceryl transferase"
/protein_id="AQW34364.1"
gene 1698588..1698986
/locus_tag="B1761_09235"
CDS 1698588..1698986
/locus_tag="B1761_09235"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952716.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DUF948 domain containing protein"
/protein_id="AQW34365.1"
gene 1698999..1699439
/locus_tag="B1761_09240"
CDS 1698999..1699439
/locus_tag="B1761_09240"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946001.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34366.1"
gene complement(1699460..1699756)
/locus_tag="B1761_09245"
CDS complement(1699460..1699756)
/locus_tag="B1761_09245"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002945999.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34367.1"
gene 1699986..1700915
/locus_tag="B1761_09250"
CDS 1699986..1700915
/locus_tag="B1761_09250"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004226732.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase U32"
/protein_id="AQW34368.1"
gene 1701012..1702298
/locus_tag="B1761_09255"
CDS 1701012..1702298
/locus_tag="B1761_09255"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014713639.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="protease"
/protein_id="AQW34369.1"
gene 1702298..1702618
/locus_tag="B1761_09260"
CDS 1702298..1702618
/locus_tag="B1761_09260"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002945993.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34370.1"
gene complement(1702669..1703208)
/locus_tag="B1761_09265"
CDS complement(1702669..1703208)
/locus_tag="B1761_09265"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225738.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="BioY family transporter"
/protein_id="AQW34371.1"
gene complement(1703303..1703587)
/locus_tag="B1761_09270"
CDS complement(1703303..1703587)
/locus_tag="B1761_09270"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952725.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34372.1"
gene 1703713..1703925
/locus_tag="B1761_09275"
CDS 1703713..1703925
/locus_tag="B1761_09275"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015605433.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34373.1"
gene complement(1703961..1705295)
/locus_tag="B1761_09280"
CDS complement(1703961..1705295)
/locus_tag="B1761_09280"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_007521515.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="divalent metal cation transporter"
/protein_id="AQW34374.1"
gene 1705504..1705812
/locus_tag="B1761_09285"
CDS 1705504..1705812
/locus_tag="B1761_09285"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946227.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34375.1"
gene complement(1705851..1707125)
/locus_tag="B1761_09290"
CDS complement(1705851..1707125)
/locus_tag="B1761_09290"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002886006.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA (cytosine-5-)-methyltransferase"
/protein_id="AQW34376.1"
gene 1707243..1708733
/locus_tag="B1761_09295"
CDS 1707243..1708733
/locus_tag="B1761_09295"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003712295.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA mismatch repair protein MutH"
/protein_id="AQW34377.1"
gene 1708770..1709087
/locus_tag="B1761_09300"
CDS 1708770..1709087
/locus_tag="B1761_09300"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608151.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34378.1"
gene 1709071..1710000
/locus_tag="B1761_09305"
CDS 1709071..1710000
/locus_tag="B1761_09305"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608152.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34379.1"
gene complement(1710228..1711718)
/locus_tag="B1761_09310"
CDS complement(1710228..1711718)
/locus_tag="B1761_09310"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018165051.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lysine--tRNA ligase"
/protein_id="AQW34380.1"
gene 1711924..1713255
/locus_tag="B1761_09315"
CDS 1711924..1713255
/locus_tag="B1761_09315"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621393.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidoglycan-binding protein"
/protein_id="AQW34381.1"
gene 1713269..1713748
/locus_tag="B1761_09320"
CDS 1713269..1713748
/locus_tag="B1761_09320"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182767.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34382.1"
gene 1714062..1714964
/locus_tag="B1761_09325"
CDS 1714062..1714964
/locus_tag="B1761_09325"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000633099.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="HAD family hydrolase"
/protein_id="AQW34383.1"
gene 1715161..1715355
/locus_tag="B1761_09330"
CDS 1715161..1715355
/locus_tag="B1761_09330"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952762.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34384.1"
gene complement(1715388..1716026)
/locus_tag="B1761_09335"
CDS complement(1715388..1716026)
/locus_tag="B1761_09335"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727397.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidine phosphatase family protein"
/protein_id="AQW34385.1"
gene complement(1716029..1716502)
/locus_tag="B1761_09340"
CDS complement(1716029..1716502)
/locus_tag="B1761_09340"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990824.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminoacyl-tRNA deacylase"
/protein_id="AQW34386.1"
gene complement(1716617..1717564)
/locus_tag="B1761_09345"
CDS complement(1716617..1717564)
/locus_tag="B1761_09345"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608156.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="N-acetylmuramoyl-L-alanine amidase"
/protein_id="AQW34387.1"
gene complement(1717756..1718145)
/locus_tag="B1761_09350"
CDS complement(1717756..1718145)
/locus_tag="B1761_09350"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948103.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sodium transporter"
/protein_id="AQW34388.1"
gene complement(1718401..1719027)
/locus_tag="B1761_09355"
CDS complement(1718401..1719027)
/locus_tag="B1761_09355"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948102.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34389.1"
gene 1719139..1719563
/locus_tag="B1761_09360"
/pseudo
CDS 1719139..1719563
/locus_tag="B1761_09360"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182760.1"
/note="frameshifted; internal stop; incomplete; partial on
complete genome; missing stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1720095..1723163
/locus_tag="B1761_09365"
CDS 1720095..1723163
/locus_tag="B1761_09365"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001074789.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DEAD/DEAH box helicase"
/protein_id="AQW34390.1"
gene 1723163..1724767
/locus_tag="B1761_09370"
CDS 1723163..1724767
/locus_tag="B1761_09370"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002914305.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="SAM-dependent methyltransferase"
/protein_id="AQW34391.1"
gene 1724760..1725992
/locus_tag="B1761_09375"
CDS 1724760..1725992
/locus_tag="B1761_09375"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608163.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type I restriction endonuclease"
/protein_id="AQW34392.1"
gene 1726043..1726758
/locus_tag="B1761_09380"
/pseudo
CDS 1726043..1726758
/locus_tag="B1761_09380"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002927542.1"
/note="frameshifted; incomplete; partial on complete
genome; missing stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1726803..1727804
/locus_tag="B1761_09385"
CDS 1726803..1727804
/locus_tag="B1761_09385"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950355.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="deoxyribonuclease"
/protein_id="AQW34393.1"
gene complement(1727794..1727976)
/locus_tag="B1761_09390"
CDS complement(1727794..1727976)
/locus_tag="B1761_09390"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950359.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34560.1"
gene 1727954..1728514
/locus_tag="B1761_09395"
CDS 1727954..1728514
/locus_tag="B1761_09395"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534254.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34394.1"
gene 1728516..1729415
/locus_tag="B1761_09400"
CDS 1728516..1729415
/locus_tag="B1761_09400"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182744.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="protease HtpX"
/protein_id="AQW34395.1"
gene 1729533..1730006
/locus_tag="B1761_09405"
CDS 1729533..1730006
/locus_tag="B1761_09405"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946634.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34396.1"
gene 1730003..1730398
/locus_tag="B1761_09410"
CDS 1730003..1730398
/locus_tag="B1761_09410"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097454.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cobalamin ECF transporter"
/protein_id="AQW34397.1"
gene 1730574..1733396
/locus_tag="B1761_09415"
CDS 1730574..1733396
/locus_tag="B1761_09415"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890650.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoenolpyruvate carboxylase"
/protein_id="AQW34398.1"
gene 1733464..1734498
/locus_tag="B1761_09420"
CDS 1733464..1734498
/locus_tag="B1761_09420"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946639.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA polymerase III subunit delta"
/protein_id="AQW34399.1"
gene 1734593..1735198
/locus_tag="B1761_09425"
CDS 1734593..1735198
/locus_tag="B1761_09425"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018165254.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="superoxide dismutase"
/protein_id="AQW34561.1"
gene complement(1735269..1736525)
/locus_tag="B1761_09430"
/pseudo
CDS complement(1735269..1736525)
/locus_tag="B1761_09430"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011226023.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 1736714..1738093
/locus_tag="B1761_09435"
CDS 1736714..1738093
/locus_tag="B1761_09435"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608170.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptidase family S11"
/protein_id="AQW34400.1"
gene complement(1738134..1738781)
/locus_tag="B1761_09440"
CDS complement(1738134..1738781)
/locus_tag="B1761_09440"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950388.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="precorrin-2 dehydrogenase"
/protein_id="AQW34401.1"
gene 1738890..1739411
/locus_tag="B1761_09445"
CDS 1738890..1739411
/locus_tag="B1761_09445"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621418.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA starvation/stationary phase protection
protein"
/protein_id="AQW34402.1"
gene 1739500..1739937
/locus_tag="B1761_09450"
CDS 1739500..1739937
/locus_tag="B1761_09450"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094453.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional repressor"
/protein_id="AQW34403.1"
gene 1740048..1740254
/locus_tag="B1761_09455"
CDS 1740048..1740254
/locus_tag="B1761_09455"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950395.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34404.1"
gene 1740247..1741215
/locus_tag="B1761_09460"
CDS 1740247..1741215
/locus_tag="B1761_09460"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094633.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glucokinase"
/protein_id="AQW34405.1"
gene 1741353..1743203
/locus_tag="B1761_09465"
CDS 1741353..1743203
/locus_tag="B1761_09465"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887637.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="GTP-binding protein TypA"
/protein_id="AQW34406.1"
gene 1743223..1743495
/locus_tag="B1761_09470"
CDS 1743223..1743495
/locus_tag="B1761_09470"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950398.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34407.1"
gene 1743619..1744971
/locus_tag="B1761_09475"
CDS 1743619..1744971
/locus_tag="B1761_09475"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681001.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="UDP-N-acetylmuramoyl-L-alanine--D-glutamate
ligase"
/protein_id="AQW34408.1"
gene 1744975..1746045
/locus_tag="B1761_09480"
CDS 1744975..1746045
/locus_tag="B1761_09480"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225775.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="undecaprenyldiphospho-muramoylpentapeptide
beta-N- acetylglucosaminyltransferase"
/protein_id="AQW34409.1"
gene 1746055..1747179
/locus_tag="B1761_09485"
CDS 1746055..1747179
/locus_tag="B1761_09485"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952798.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein FtsQ"
/protein_id="AQW34410.1"
gene 1747303..1748679
/locus_tag="B1761_09490"
CDS 1747303..1748679
/locus_tag="B1761_09490"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727414.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein FtsA"
/protein_id="AQW34411.1"
gene 1748708..1750030
/locus_tag="B1761_09495"
CDS 1748708..1750030
/locus_tag="B1761_09495"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003062681.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein FtsZ"
/protein_id="AQW34412.1"
gene 1750033..1750716
/locus_tag="B1761_09500"
CDS 1750033..1750716
/locus_tag="B1761_09500"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002883987.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="YggS family pyridoxal phosphate enzyme"
/protein_id="AQW34413.1"
gene 1750721..1751290
/locus_tag="B1761_09505"
CDS 1750721..1751290
/locus_tag="B1761_09505"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608177.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein SepF"
/protein_id="AQW34414.1"
gene 1751294..1751551
/locus_tag="B1761_09510"
CDS 1751294..1751551
/locus_tag="B1761_09510"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608178.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="YggT family protein"
/protein_id="AQW34415.1"
gene 1751551..1752351
/locus_tag="B1761_09515"
CDS 1751551..1752351
/locus_tag="B1761_09515"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946448.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNA-binding protein"
/protein_id="AQW34416.1"
gene 1752464..1752529
/locus_tag="B1761_09520"
/pseudo
CDS 1752464..1752529
/locus_tag="B1761_09520"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097439.1"
/note="incomplete; partial on complete genome; missing
start; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="cell division protein"
gene 1752595..1753470
/locus_tag="B1761_09525"
CDS 1752595..1753470
/locus_tag="B1761_09525"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002946449.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cell division protein DivIVA"
/protein_id="AQW34417.1"
gene 1753718..1756507
/locus_tag="B1761_09530"
CDS 1753718..1756507
/locus_tag="B1761_09530"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950408.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="isoleucine--tRNA ligase"
/protein_id="AQW34418.1"
gene complement(1756539..1757494)
/locus_tag="B1761_09535"
/pseudo
CDS complement(1756539..1757494)
/locus_tag="B1761_09535"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014334555.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 1757723..1758985
/locus_tag="B1761_09540"
CDS 1757723..1758985
/locus_tag="B1761_09540"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182364.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34419.1"
gene complement(1759108..1759374)
/locus_tag="B1761_09545"
CDS complement(1759108..1759374)
/locus_tag="B1761_09545"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002887852.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="50S ribosomal protein L31"
/protein_id="AQW34420.1"
gene complement(1759456..1760388)
/locus_tag="B1761_09550"
CDS complement(1759456..1760388)
/locus_tag="B1761_09550"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950414.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thiamine biosynthesis protein ApbE"
/protein_id="AQW34421.1"
gene complement(1760342..1761319)
/locus_tag="B1761_09555"
CDS complement(1760342..1761319)
/locus_tag="B1761_09555"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681013.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DHH family phosphoesterase"
/protein_id="AQW34422.1"
gene complement(1761400..1762188)
/locus_tag="B1761_09560"
CDS complement(1761400..1762188)
/locus_tag="B1761_09560"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681014.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="glutathione S-transferase"
/protein_id="AQW34423.1"
gene 1762358..1763368
/locus_tag="B1761_09565"
CDS 1762358..1763368
/locus_tag="B1761_09565"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990443.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="adenosine deaminase family protein"
/protein_id="AQW34424.1"
gene 1763597..1764187
/locus_tag="B1761_09570"
CDS 1763597..1764187
/locus_tag="B1761_09570"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227082.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="thymidine kinase"
/protein_id="AQW34425.1"
gene 1764230..1765309
/locus_tag="B1761_09575"
CDS 1764230..1765309
/locus_tag="B1761_09575"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002262255.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide chain release factor 1"
/protein_id="AQW34426.1"
gene 1765306..1766139
/locus_tag="B1761_09580"
CDS 1765306..1766139
/locus_tag="B1761_09580"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950424.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="protein-(glutamine-N5) methyltransferase,
release factor-specific"
/protein_id="AQW34427.1"
gene 1766126..1766731
/locus_tag="B1761_09585"
CDS 1766126..1766731
/locus_tag="B1761_09585"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011225789.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="threonylcarbamoyl-AMP synthase"
/protein_id="AQW34428.1"
gene 1766826..1768076
/gene="glyA"
/locus_tag="B1761_09590"
CDS 1766826..1768076
/gene="glyA"
/locus_tag="B1761_09590"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001863152.1"
/note="catalyzes the reaction of glycine with
5,10-methylenetetrahydrofolate to form L-serine and
tetrahydrofolate; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine hydroxymethyltransferase"
/protein_id="AQW34429.1"
gene 1768083..1769060
/locus_tag="B1761_09595"
CDS 1768083..1769060
/locus_tag="B1761_09595"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_009854139.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="nucleoid-associated bacterial family protein"
/protein_id="AQW34430.1"
gene 1769062..1769673
/locus_tag="B1761_09600"
CDS 1769062..1769673
/locus_tag="B1761_09600"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621429.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="lytic transglycosylase"
/protein_id="AQW34431.1"
gene 1769706..1771445
/locus_tag="B1761_09605"
CDS 1769706..1771445
/locus_tag="B1761_09605"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891155.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="multidrug ABC transporter ATP-binding protein"
/protein_id="AQW34432.1"
gene 1771435..1773183
/locus_tag="B1761_09610"
CDS 1771435..1773183
/locus_tag="B1761_09610"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950434.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="sugar ABC transporter ATP-binding protein"
/protein_id="AQW34433.1"
gene 1773363..1773494
/locus_tag="B1761_09615"
CDS 1773363..1773494
/locus_tag="B1761_09615"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002928498.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanyl-lipoteichoic acid biosynthesis protein"
/protein_id="AQW34562.1"
gene 1773503..1775053
/locus_tag="B1761_09620"
CDS 1773503..1775053
/locus_tag="B1761_09620"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534838.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanine--poly(phosphoribitol) ligase"
/protein_id="AQW34434.1"
gene 1775050..1776297
/locus_tag="B1761_09625"
CDS 1775050..1776297
/locus_tag="B1761_09625"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681023.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanyl-lipoteichoic acid biosynthesis protein
DltB"
/protein_id="AQW34435.1"
gene 1776315..1776554
/locus_tag="B1761_09630"
CDS 1776315..1776554
/locus_tag="B1761_09630"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_005591431.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanine--poly(phosphoribitol) ligase subunit
2"
/protein_id="AQW34436.1"
gene 1776547..1777815
/locus_tag="B1761_09635"
CDS 1776547..1777815
/locus_tag="B1761_09635"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002885157.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="D-alanyl-lipoteichoic acid biosynthesis protein
DltD"
/protein_id="AQW34437.1"
gene complement(1777925..1779181)
/locus_tag="B1761_09640"
CDS complement(1777925..1779181)
/locus_tag="B1761_09640"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608187.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
/protein_id="AQW34438.1"
gene complement(1779293..1779775)
/locus_tag="B1761_09645"
/pseudo
CDS complement(1779293..1779775)
/locus_tag="B1761_09645"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011680582.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(1779789..1780692)
/locus_tag="B1761_09650"
/pseudo
CDS complement(1779789..1780692)
/locus_tag="B1761_09650"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_001847373.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transposase"
gene complement(1780835..1783471)
/locus_tag="B1761_09655"
CDS complement(1780835..1783471)
/locus_tag="B1761_09655"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727421.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="calcium-translocating P-type ATPase, PMCA-type"
/protein_id="AQW34439.1"
gene complement(1783648..1785366)
/locus_tag="B1761_09660"
CDS complement(1783648..1785366)
/locus_tag="B1761_09660"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950449.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aminodeoxychorismate synthase, component I"
/protein_id="AQW34440.1"
gene 1785887..1786777
/locus_tag="B1761_09665"
CDS 1785887..1786777
/locus_tag="B1761_09665"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608194.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein"
/protein_id="AQW34441.1"
gene complement(1787851..1788300)
/locus_tag="B1761_09670"
CDS complement(1787851..1788300)
/locus_tag="B1761_09670"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681031.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34442.1"
gene complement(1788519..1788794)
/locus_tag="B1761_09675"
CDS complement(1788519..1788794)
/locus_tag="B1761_09675"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681032.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34443.1"
gene complement(1788811..1788996)
/locus_tag="B1761_09680"
CDS complement(1788811..1788996)
/locus_tag="B1761_09680"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681033.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34444.1"
gene complement(1789292..1790797)
/locus_tag="B1761_09685"
CDS complement(1789292..1790797)
/locus_tag="B1761_09685"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681035.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA primase"
/protein_id="AQW34445.1"
gene complement(1790787..1791647)
/locus_tag="B1761_09690"
CDS complement(1790787..1791647)
/locus_tag="B1761_09690"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681036.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34446.1"
gene complement(1791662..1791934)
/locus_tag="B1761_09695"
CDS complement(1791662..1791934)
/locus_tag="B1761_09695"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681037.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW34447.1"
gene complement(1791936..1792247)
/locus_tag="B1761_09700"
CDS complement(1791936..1792247)
/locus_tag="B1761_09700"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608197.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34563.1"
gene complement(1792264..1792500)
/locus_tag="B1761_09705"
CDS complement(1792264..1792500)
/locus_tag="B1761_09705"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011227100.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34448.1"
gene complement(1792514..1792708)
/locus_tag="B1761_09710"
CDS complement(1792514..1792708)
/locus_tag="B1761_09710"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608198.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34449.1"
gene complement(1792712..1793005)
/locus_tag="B1761_09715"
CDS complement(1792712..1793005)
/locus_tag="B1761_09715"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608199.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34450.1"
gene complement(1793244..1793441)
/locus_tag="B1761_09720"
CDS complement(1793244..1793441)
/locus_tag="B1761_09720"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_006739557.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
/protein_id="AQW34451.1"
gene 1793604..1793852
/locus_tag="B1761_09725"
/pseudo
CDS 1793604..1793852
/locus_tag="B1761_09725"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948197.1"
/note="incomplete; partial on complete genome; missing
stop; Derived by automated computational analysis using
gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="transcriptional regulator"
gene 1794199..1795365
/locus_tag="B1761_09730"
CDS 1794199..1795365
/locus_tag="B1761_09730"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002890430.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="site-specific integrase"
/protein_id="AQW34452.1"
gene 1795481..1795816
/locus_tag="B1761_09735"
CDS 1795481..1795816
/locus_tag="B1761_09735"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950450.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34453.1"
gene 1796144..1798393
/locus_tag="B1761_09740"
CDS 1796144..1798393
/locus_tag="B1761_09740"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_015604348.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="5-methyltetrahydropteroyltriglutamate--
homocysteine methyltransferase"
/protein_id="AQW34454.1"
gene 1798582..1799457
/locus_tag="B1761_09745"
CDS 1798582..1799457
/locus_tag="B1761_09745"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950455.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="methylenetetrahydrofolate reductase [NAD(P)H]"
/protein_id="AQW34455.1"
gene complement(1799597..1801315)
/locus_tag="B1761_09750"
CDS complement(1799597..1801315)
/locus_tag="B1761_09750"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004182388.1"
/note="catalyzes the interconversion of alpha-D-glucose
1-phosphate to alpha-D-glucose 6-phosphate; Derived by
automated computational analysis using gene prediction
method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphoglucomutase"
/protein_id="AQW34456.1"
gene complement(1801398..1801970)
/locus_tag="B1761_09755"
CDS complement(1801398..1801970)
/locus_tag="B1761_09755"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003088335.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ECF transporter S component"
/protein_id="AQW34457.1"
gene complement(1801998..1802543)
/locus_tag="B1761_09760"
CDS complement(1801998..1802543)
/locus_tag="B1761_09760"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950459.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphopantothenoylcysteine decarboxylase"
/protein_id="AQW34458.1"
gene complement(1802536..1803219)
/locus_tag="B1761_09765"
CDS complement(1802536..1803219)
/locus_tag="B1761_09765"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950461.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="phosphopantothenate--cysteine ligase"
/protein_id="AQW34459.1"
gene 1803413..1805083
/locus_tag="B1761_09770"
CDS 1803413..1805083
/locus_tag="B1761_09770"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_018375545.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="formate--tetrahydrofolate ligase"
/protein_id="AQW34460.1"
gene 1805269..1805355
/locus_tag="B1761_09775"
CDS 1805269..1805355
/locus_tag="B1761_09775"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948208.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="CiaR"
/protein_id="AQW34461.1"
gene 1805407..1805943
/locus_tag="B1761_09780"
/pseudo
CDS 1805407..1805943
/locus_tag="B1761_09780"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002948209.1"
/note="internal stop; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="two-component system response regulator"
gene 1805933..1806232
/locus_tag="B1761_09785"
CDS 1805933..1806232
/locus_tag="B1761_09785"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621440.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidine kinase"
/protein_id="AQW34462.1"
gene 1806310..1806633
/locus_tag="B1761_09790"
CDS 1806310..1806633
/locus_tag="B1761_09790"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621441.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="histidine kinase"
/protein_id="AQW34463.1"
gene 1806641..1807354
/locus_tag="B1761_09795"
/pseudo
CDS 1806641..1807354
/locus_tag="B1761_09795"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950481.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ATPase"
gene 1807455..1808141
/locus_tag="B1761_09800"
CDS 1807455..1808141
/locus_tag="B1761_09800"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681053.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW34464.1"
gene 1808156..1809025
/locus_tag="B1761_09805"
CDS 1808156..1809025
/locus_tag="B1761_09805"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681054.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="transposase"
/protein_id="AQW34465.1"
gene complement(1809130..1809381)
/locus_tag="B1761_09810"
CDS complement(1809130..1809381)
/locus_tag="B1761_09810"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534814.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="30S ribosomal protein S20"
/protein_id="AQW34466.1"
gene complement(1809435..1810355)
/locus_tag="B1761_09815"
CDS complement(1809435..1810355)
/locus_tag="B1761_09815"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004226999.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="type I pantothenate kinase"
/protein_id="AQW34467.1"
gene 1810678..1811268
/locus_tag="B1761_09820"
CDS 1810678..1811268
/locus_tag="B1761_09820"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727541.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="methyltransferase"
/protein_id="AQW34468.1"
gene 1811265..1812498
/gene="deoA"
/locus_tag="B1761_09825"
/pseudo
CDS 1811265..1812498
/gene="deoA"
/locus_tag="B1761_09825"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094462.1"
/note="Catalyzes the reversible phosphorolysis of
thymidine, deoxyuridine and their analogues to their
respective bases and 2-deoxyribose 1-phosphate;
frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="pyrimidine-nucleoside phosphorylase"
gene 1812571..1813233
/locus_tag="B1761_09830"
/pseudo
CDS 1812571..1813233
/locus_tag="B1761_09830"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003088419.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="deoxyribose-phosphate aldolase"
gene 1813220..1813618
/locus_tag="B1761_09835"
CDS 1813220..1813618
/locus_tag="B1761_09835"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950496.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cytidine deaminase"
/protein_id="AQW34469.1"
gene 1813681..1814751
/locus_tag="B1761_09840"
CDS 1813681..1814751
/locus_tag="B1761_09840"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014634597.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="BMP family ABC transporter substrate-binding
protein"
/protein_id="AQW34470.1"
gene 1814865..1816403
/locus_tag="B1761_09845"
CDS 1814865..1816403
/locus_tag="B1761_09845"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990473.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="heme ABC transporter ATP-binding protein"
/protein_id="AQW34471.1"
gene 1816396..1817463
/locus_tag="B1761_09850"
CDS 1816396..1817463
/locus_tag="B1761_09850"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990474.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW34472.1"
gene 1817465..1818421
/locus_tag="B1761_09855"
CDS 1817465..1818421
/locus_tag="B1761_09855"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003105285.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ABC transporter permease"
/protein_id="AQW34473.1"
gene complement(1818525..1819160)
/locus_tag="B1761_09860"
CDS complement(1818525..1819160)
/locus_tag="B1761_09860"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_008534802.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="MBL fold metallo-hydrolase"
/protein_id="AQW34474.1"
gene 1819255..1821741
/locus_tag="B1761_09865"
CDS 1819255..1821741
/locus_tag="B1761_09865"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727536.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bifunctional DnaQ family
exonuclease/ATP-dependent helicase"
/protein_id="AQW34475.1"
gene 1821886..1822368
/locus_tag="B1761_09870"
CDS 1821886..1822368
/locus_tag="B1761_09870"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011681058.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34476.1"
gene 1822373..1823554
/locus_tag="B1761_09875"
CDS 1822373..1823554
/locus_tag="B1761_09875"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_013990479.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="aspartate aminotransferase"
/protein_id="AQW34477.1"
gene 1823591..1824937
/locus_tag="B1761_09880"
CDS 1823591..1824937
/locus_tag="B1761_09880"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000038477.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="asparagine--tRNA ligase"
/protein_id="AQW34478.1"
gene 1825142..1825372
/locus_tag="B1761_09885"
CDS 1825142..1825372
/locus_tag="B1761_09885"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_004197260.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34564.1"
gene complement(1825436..1826246)
/locus_tag="B1761_09890"
/pseudo
CDS complement(1825436..1826246)
/locus_tag="B1761_09890"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002952942.1"
/note="frameshifted; internal stop; Derived by automated
computational analysis using gene prediction method:
Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
gene 1826454..1826834
/locus_tag="B1761_09895"
CDS 1826454..1826834
/locus_tag="B1761_09895"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002891112.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RidA family protein"
/protein_id="AQW34479.1"
gene 1827009..1827662
/locus_tag="B1761_09900"
CDS 1827009..1827662
/locus_tag="B1761_09900"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014727531.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="7-cyano-7-deazaguanine synthase QueC"
/protein_id="AQW34480.1"
gene 1827662..1828105
/locus_tag="B1761_09905"
CDS 1827662..1828105
/locus_tag="B1761_09905"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000464568.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="6-carboxytetrahydropterin synthase QueD"
/protein_id="AQW34481.1"
gene 1828098..1828814
/locus_tag="B1761_09910"
CDS 1828098..1828814
/locus_tag="B1761_09910"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002950529.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="7-carboxy-7-deazaguanine synthase QueE"
/protein_id="AQW34482.1"
gene 1828934..1829425
/locus_tag="B1761_09915"
CDS 1828934..1829425
/locus_tag="B1761_09915"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_000082574.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="NADPH-dependent 7-cyano-7-deazaguanine reductase
QueF"
/protein_id="AQW34483.1"
gene 1829823..1830005
/locus_tag="B1761_09920"
/pseudo
CDS 1829823..1830005
/locus_tag="B1761_09920"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003094489.1"
/note="frameshifted; Derived by automated computational
analysis using gene prediction method: Protein Homology."
/pseudo
/codon_start=1
/transl_table=11
/product="hypothetical protein"
gene 1830246..1830434
/locus_tag="B1761_09925"
CDS 1830246..1830434
/locus_tag="B1761_09925"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014621465.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="serine protease"
/protein_id="AQW34484.1"
gene 1830639..1831409
/locus_tag="B1761_09930"
CDS 1830639..1831409
/locus_tag="B1761_09930"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608217.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cyclic nucleotide-binding protein"
/protein_id="AQW34485.1"
gene 1831390..1832280
/locus_tag="B1761_09935"
CDS 1831390..1832280
/locus_tag="B1761_09935"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003063956.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="RNase adaptor protein RapZ"
/protein_id="AQW34486.1"
gene 1832277..1833251
/locus_tag="B1761_09940"
CDS 1832277..1833251
/locus_tag="B1761_09940"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608218.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="YvcK family protein"
/protein_id="AQW34487.1"
gene 1833248..1834159
/locus_tag="B1761_09945"
CDS 1833248..1834159
/locus_tag="B1761_09945"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_003097366.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="DNA-binding protein WhiA"
/protein_id="AQW34488.1"
gene 1834177..1834398
/locus_tag="B1761_09950"
CDS 1834177..1834398
/locus_tag="B1761_09950"
/inference="COORDINATES: protein motif:HMM:PF03577.13"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="hypothetical protein"
/protein_id="AQW34489.1"
gene 1834448..1834927
/locus_tag="B1761_09955"
CDS 1834448..1834927
/locus_tag="B1761_09955"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014608219.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="dipeptidase"
/protein_id="AQW34490.1"
gene 1834934..1835170
/locus_tag="B1761_09960"
CDS 1834934..1835170
/locus_tag="B1761_09960"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002944721.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="peptide hydrolase"
/protein_id="AQW34491.1"
gene 1835121..1835339 /locus_tag="B1761_09965"
CDS 1835121..1835339
/locus_tag="B1761_09965"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011675683.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="bacteriocin"
/protein_id="AQW34492.1"
gene 1835470..1835670
/locus_tag="B1761_09970"
CDS 1835470..1835670
/locus_tag="B1761_09970"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_002944716.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cold-shock protein"
/protein_id="AQW34493.1"
gene complement(1835717..1837045)
/locus_tag="B1761_09975"
CDS complement(1835717..1837045)
/locus_tag="B1761_09975"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014607930.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="ISL3 family transposase"
/protein_id="AQW34494.1"
gene 1837374..1837574
/locus_tag="B1761_09980"
CDS 1837374..1837574
/locus_tag="B1761_09980"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_014570681.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="cold-shock protein"
/protein_id="AQW34495.1"
gene 1837905..1839080
/locus_tag="B1761_09985"
CDS 1837905..1839080
/locus_tag="B1761_09985"
/inference="COORDINATES: similar to AA
sequence:RefSeq:WP_011675534.1"
/note="Derived by automated computational analysis using
gene prediction method: Protein Homology."
/codon_start=1
/transl_table=11
/product="IS256 family transposase"
/protein_id="AQW34496.1"
ORIGIN
//